ID: 1150699860

View in Genome Browser
Species Human (GRCh38)
Location 17:67437353-67437375
Sequence AGATAGCCCCTTGAACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150699856_1150699860 18 Left 1150699856 17:67437312-67437334 CCTTATAGGAAGGGGAGCGGACA 0: 1
1: 0
2: 4
3: 34
4: 244
Right 1150699860 17:67437353-67437375 AGATAGCCCCTTGAACATGGAGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150699860 Original CRISPR AGATAGCCCCTTGAACATGG AGG Intronic