ID: 1150702649

View in Genome Browser
Species Human (GRCh38)
Location 17:67461150-67461172
Sequence GAGAAGAAGCAGGAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2969
Summary {0: 1, 1: 1, 2: 47, 3: 410, 4: 2510}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150702649_1150702656 26 Left 1150702649 17:67461150-67461172 CCTGCCTCCTCCTGCTTCTTCTC 0: 1
1: 1
2: 47
3: 410
4: 2510
Right 1150702656 17:67461199-67461221 ATGAAAAGACCAGATTCCACTGG 0: 1
1: 0
2: 2
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150702649 Original CRISPR GAGAAGAAGCAGGAGGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr