ID: 1150703758

View in Genome Browser
Species Human (GRCh38)
Location 17:67469549-67469571
Sequence GGCCGCTGGTCTGAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 2, 2: 2, 3: 13, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150703758_1150703769 27 Left 1150703758 17:67469549-67469571 CCAGCACACTCAGACCAGCGGCC 0: 1
1: 2
2: 2
3: 13
4: 154
Right 1150703769 17:67469599-67469621 ACCCGTGGGAGTTCAGGTGCGGG 0: 1
1: 0
2: 0
3: 9
4: 82
1150703758_1150703767 21 Left 1150703758 17:67469549-67469571 CCAGCACACTCAGACCAGCGGCC 0: 1
1: 2
2: 2
3: 13
4: 154
Right 1150703767 17:67469593-67469615 CGTCAGACCCGTGGGAGTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1150703758_1150703768 26 Left 1150703758 17:67469549-67469571 CCAGCACACTCAGACCAGCGGCC 0: 1
1: 2
2: 2
3: 13
4: 154
Right 1150703768 17:67469598-67469620 GACCCGTGGGAGTTCAGGTGCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1150703758_1150703764 12 Left 1150703758 17:67469549-67469571 CCAGCACACTCAGACCAGCGGCC 0: 1
1: 2
2: 2
3: 13
4: 154
Right 1150703764 17:67469584-67469606 GACAGCAGCCGTCAGACCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1150703758_1150703765 13 Left 1150703758 17:67469549-67469571 CCAGCACACTCAGACCAGCGGCC 0: 1
1: 2
2: 2
3: 13
4: 154
Right 1150703765 17:67469585-67469607 ACAGCAGCCGTCAGACCCGTGGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150703758 Original CRISPR GGCCGCTGGTCTGAGTGTGC TGG (reversed) Intronic
900154997 1:1200371-1200393 CGCTGCTGGTGAGAGTGTGCTGG - Intergenic
900700729 1:4047267-4047289 AGCTGCTGGGCTGAGAGTGCTGG + Intergenic
904603251 1:31684880-31684902 GGTGGCTGGTATGAGTGAGCGGG - Intronic
905867816 1:41385752-41385774 GGCCGCTGGTGTGTGTGCGCAGG + Intergenic
905871970 1:41409644-41409666 GGCCTCTGGTGGGAGTGTGTGGG + Intergenic
915096164 1:153464302-153464324 TGACTCTGTTCTGAGTGTGCAGG + Intergenic
915636928 1:157194104-157194126 GTCAGCTGGTCTGAGAGAGCCGG - Intergenic
917533383 1:175856534-175856556 GGCCGTGGGGCTGTGTGTGCTGG - Intergenic
918093615 1:181317395-181317417 GGCCGCTGGCCTTACTGGGCAGG - Intergenic
920499098 1:206475016-206475038 TGCCGCTGGTCTGAGGGTGGAGG - Intronic
923018956 1:230148210-230148232 GGCCACTGATCTGGTTGTGCCGG - Intronic
1067080579 10:43210171-43210193 GGCCCCTGCTCTGAGTTAGCCGG - Intronic
1069724042 10:70566147-70566169 GGCGGCAGGGCTGAGTGTCCAGG + Intronic
1069961495 10:72081806-72081828 GGGCGCTGGTCTGATTGTGTGGG - Intronic
1074360333 10:112820456-112820478 TGCCACTGGTCTGAGTCTGATGG - Intergenic
1076640143 10:131910128-131910150 GGCAGCGTGTTTGAGTGTGCCGG + Intronic
1077097044 11:803510-803532 GCCCGCTGGTCTGAGTGGCCTGG - Exonic
1077130852 11:971734-971756 GGCCACGCGTCTGAGTGTTCCGG - Intronic
1077239286 11:1502288-1502310 GGCCCCTGGCCTGGGTGGGCTGG - Intergenic
1078552448 11:12289982-12290004 GGCAGCTGGTATGTGTGTGAAGG + Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1089479268 11:118791733-118791755 GGGCGCGCGTCTGAGTGTGGGGG + Intergenic
1096555930 12:52403766-52403788 GGCAGCTGGACTGTGTGTCCGGG - Exonic
1097274372 12:57802255-57802277 GGCCGCTGGGGTGAGTGTGCAGG + Exonic
1103944098 12:124516795-124516817 GGCACCTGGTCTGAGGGTGGGGG - Intronic
1104008839 12:124914860-124914882 GGCCGCTGTCCTGAGCGTCCGGG + Exonic
1104104808 12:125649408-125649430 GGCAGCTGGTCTGGCTGTGTGGG + Intronic
1104922200 12:132296299-132296321 GTCCGCTGGTCTGAGTGGGCTGG - Intronic
1108153502 13:47561253-47561275 AGCTGCTGGTCTGAGTATGGAGG - Intergenic
1113694120 13:112331867-112331889 GGCCCCAGGTCTGAGTGCACAGG + Intergenic
1116441830 14:44962659-44962681 AGCAGCTGGTCTGAGTCTGGAGG + Exonic
1116891873 14:50276639-50276661 GACCTCTTGTCTGTGTGTGCCGG - Intronic
1122977938 14:105178620-105178642 GGCAGATGGGCTGAGCGTGCCGG - Intronic
1124254655 15:28130956-28130978 GGCCTCTGCTCTGAGAGGGCTGG - Intronic
1127638230 15:60891390-60891412 GGCAGCTGCTCTGAATATGCAGG + Intronic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1129294001 15:74589658-74589680 GACAGCTAGTCTGAGTGTTCAGG + Intronic
1130251982 15:82305711-82305733 GGCCGCTTCTCTGCCTGTGCAGG + Intergenic
1130882017 15:88063430-88063452 GGCTTCTGGGCTGAGTGTTCAGG - Intronic
1131064666 15:89426525-89426547 GACAGCAGGTCTGACTGTGCTGG - Intergenic
1132284929 15:100655820-100655842 TGCCACTGGCCTGTGTGTGCAGG - Intergenic
1132852110 16:2029463-2029485 GGCGGCTGGTCTGCATGGGCGGG - Intronic
1133042813 16:3069438-3069460 GGCAGGGGGACTGAGTGTGCGGG - Exonic
1133044854 16:3082080-3082102 GGCAGGGGGACTGAGTGTGCGGG - Intronic
1133285882 16:4690495-4690517 GGTGGCTGGCCTGGGTGTGCAGG - Exonic
1133879104 16:9763928-9763950 GCTCGCTGGTCTCACTGTGCGGG + Exonic
1134680399 16:16120843-16120865 CTCAGCTGGGCTGAGTGTGCTGG + Intronic
1138446455 16:57067194-57067216 GGCAGCTGGTATGGTTGTGCAGG - Intronic
1139958262 16:70703593-70703615 GGCCTCTGGGCTGTGTGTGAAGG - Intronic
1142012234 16:87721459-87721481 GGCCACAGGTCTGCGTGTGCTGG + Intronic
1142269139 16:89080055-89080077 GGCCACTGCTCTGATTGTGCAGG + Intergenic
1143159036 17:4857077-4857099 GGGCGCTGGCCTGAGTGGCCTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1145248351 17:21284355-21284377 GGCTGCGGGTCTGGGGGTGCCGG + Intergenic
1146970204 17:37066161-37066183 GGCCGCAGGTGTGTGTGTCCGGG + Intergenic
1147851817 17:43449553-43449575 GGCTGCTGCTCTGAGGCTGCAGG + Intergenic
1148078166 17:44951587-44951609 AGCAGCTGGGCTGAGTGTGGTGG + Intergenic
1148215252 17:45830628-45830650 GCCCGCTGGCCTGAGTCTGGAGG - Intronic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1150705982 17:67487753-67487775 GGCCACTGGTCTGAGGGTGGGGG + Intronic
1151765599 17:76131881-76131903 GGCAGCTGGTAGGGGTGTGCGGG + Intergenic
1152160662 17:78666668-78666690 GGCCGCTGGTCTGGGAGTGAGGG + Intergenic
1152845936 17:82599815-82599837 GGCCTGTGGTCTGAGAGGGCTGG + Intronic
1157027385 18:43861683-43861705 GGTCTTTGGGCTGAGTGTGCAGG + Intergenic
1160134592 18:76261763-76261785 GGTCTCTGAGCTGAGTGTGCAGG - Intergenic
1161725786 19:5927795-5927817 TGCTGCTGGTGTGCGTGTGCTGG - Intronic
1162217667 19:9149722-9149744 GGCCCTTGGTCTGAGTGAGATGG + Intronic
1162281745 19:9703575-9703597 GGGAGCTGGTCTGTGTGTCCTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165300062 19:34963205-34963227 GGCCTCTGTTCTGAGGGTGTTGG - Intronic
1165486428 19:36099462-36099484 GGCCGCTGGGCAGAGCGGGCCGG + Exonic
1168097557 19:54124279-54124301 GGCAGCTGGCCTGGGGGTGCAGG - Intronic
1168576108 19:57511994-57512016 GGCCTGTGGTCTGAGGGTGAAGG + Intronic
925990340 2:9249681-9249703 GGGCGCTGGGCTGAGATTGCTGG + Intronic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
926856451 2:17261587-17261609 GGCTGCTGACCTGAGGGTGCGGG - Intergenic
930090801 2:47530128-47530150 GGCCGCTGGCCTGGCTGGGCAGG - Intronic
936241473 2:110791907-110791929 GGCTTCAGGTCTGGGTGTGCAGG + Intronic
936278900 2:111121579-111121601 GGCCGCTACTCTGAGGGCGCCGG - Intronic
937746578 2:125422328-125422350 GCCGGCTGCTCTGAGTGTGCGGG - Intergenic
940362586 2:152812732-152812754 GGCCCCAGGGCTGTGTGTGCTGG + Intergenic
943188551 2:184646584-184646606 GGCTGCTGATCTAAGTGAGCAGG - Intronic
944225634 2:197346272-197346294 TGTCCCTGGTCTCAGTGTGCAGG - Intergenic
946964886 2:225027210-225027232 GGGGCCTGGTCTGGGTGTGCAGG - Intronic
947565876 2:231192665-231192687 GGCCGCTGGTCTGCCTGGGTGGG + Intergenic
948133987 2:235621906-235621928 GGCCGCTGTTCTGAGGGGGTGGG - Intronic
948428935 2:237906338-237906360 GGTCACTGCCCTGAGTGTGCAGG - Intronic
948835221 2:240623103-240623125 GGCCGCGGGGCTGCGAGTGCCGG - Intronic
949023909 2:241756031-241756053 GGCCGCGGCCCTGTGTGTGCTGG + Intronic
1170102881 20:12721553-12721575 GGCCTCTGGTCTGAAGGTGGTGG - Intergenic
1171274544 20:23844979-23845001 GGTTGCTGATCTGAGTGAGCAGG - Intergenic
1174878479 20:54251223-54251245 GACAGATGGTCTGAGTGGGCGGG + Intergenic
1175510067 20:59518141-59518163 GGGTGCTGGCCTGAGGGTGCAGG - Intergenic
1176042743 20:63073794-63073816 GGCTGTTGGTCTAAGGGTGCAGG + Intergenic
1181029291 22:20142211-20142233 GGCCAAGGGTCTGAGTCTGCAGG + Intronic
1181635328 22:24171809-24171831 GGCCGCTGGACAGAGTCAGCTGG - Exonic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1182712187 22:32330031-32330053 GGGCTCTGGTCTGTGTGTGTTGG + Intergenic
1183530717 22:38351898-38351920 GGCCACTGGGCTGTGTATGCAGG + Intronic
1183592142 22:38785650-38785672 GGCCGCAAGCCGGAGTGTGCAGG + Intronic
1184658800 22:45955844-45955866 GGCCTCTGGCCTGAGACTGCAGG - Intronic
950613553 3:14141230-14141252 AGCCTCTTGTATGAGTGTGCAGG + Intronic
950630106 3:14276639-14276661 TGCAGCTGGGCAGAGTGTGCTGG + Intergenic
950634297 3:14304079-14304101 GGTTGCTGGACTGAGTGGGCAGG + Intergenic
954467742 3:50666470-50666492 GGACGCTGGTCTGAGTGTGCAGG + Intergenic
956693840 3:71901827-71901849 GGGCTCTGGTCTGAGTGTCTGGG + Intergenic
957297958 3:78355787-78355809 GGCCGCTGGTCTAAGCTTGAGGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
961467203 3:127089193-127089215 GGCCACTGCTCTGAGTGTCCTGG + Intergenic
961701186 3:128745892-128745914 GTCCTCTGAGCTGAGTGTGCTGG + Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
963946091 3:151146895-151146917 GGCCAGTGGTCTGACTCTGCTGG + Intronic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
967635799 3:191801583-191801605 GGCCCCTAGTCTGTGTATGCTGG - Intergenic
967635813 3:191801641-191801663 TGCCCCTGGAATGAGTGTGCAGG - Intergenic
968501463 4:952072-952094 GGCCGCTAGTCTGAGTGTGCGGG + Intronic
968576086 4:1366804-1366826 GGCCGGTGTGCTGGGTGTGCAGG - Intronic
968673641 4:1865413-1865435 GGCCCCTGGTGTGTGTGTGTGGG + Intergenic
969592218 4:8128408-8128430 GGCAGCTGTACTGGGTGTGCAGG - Intronic
969592382 4:8129346-8129368 GGCAGCTGAGCTGGGTGTGCAGG - Intronic
969912854 4:10461310-10461332 GGCGGCCGAGCTGAGTGTGCGGG - Intergenic
973671065 4:53218873-53218895 AGCTGCAGGTCTGAGTTTGCTGG + Intronic
975342711 4:73259092-73259114 GGCTGCAGGGCTGTGTGTGCGGG - Intergenic
981084468 4:140668890-140668912 GGCCGCTGGGCTGGGAATGCTGG - Intronic
983287007 4:165752516-165752538 AGCTGCTGGGCTGACTGTGCTGG + Intergenic
987443876 5:17992065-17992087 GGCTGCTGCTGTGTGTGTGCTGG + Intergenic
987864257 5:23520075-23520097 GTCTGATGGTCTGAGTGTGGGGG + Intronic
988828692 5:34967231-34967253 GGTGGCTGGTCTGGGTGGGCTGG + Intergenic
994824812 5:104699186-104699208 GGCTGCTGATCTGAGTGAGTGGG - Intergenic
1000641351 5:163706172-163706194 GGCAGCTGGTCTGAGTCTCGTGG + Intergenic
1002702824 5:181138126-181138148 GGCTGGTGGTCTGAGAGTCCAGG + Intergenic
1002762132 6:210328-210350 GGCCAATGGTCTGAGGGTGTGGG - Intergenic
1004131138 6:12921345-12921367 GGGCACAGGGCTGAGTGTGCAGG + Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006502589 6:34467942-34467964 GGCCCCTGGTTTGAGTGTCCAGG + Intronic
1007302375 6:40877025-40877047 GGCTGCTGCTCAGAGTTTGCAGG + Intergenic
1007394424 6:41569588-41569610 GGGGGCTGGTCTGGGTGCGCTGG + Intronic
1012887300 6:104859998-104860020 GGGCGCAGGGCTGAGTATGCGGG + Intergenic
1013313935 6:108923655-108923677 GGCCACTGGTCTGAGCATTCAGG + Intronic
1017764663 6:157596775-157596797 TGCCGCAGGTCTGTCTGTGCTGG - Intronic
1018023513 6:159786011-159786033 ATTCACTGGTCTGAGTGTGCCGG + Intronic
1018916257 6:168134353-168134375 GGCCTCTGTCCAGAGTGTGCAGG - Intergenic
1019281868 7:204685-204707 TGCCGCTGTTCTCAGTGTTCAGG + Intronic
1019281896 7:204827-204849 TGCCGCTGTTCTCAGTGTTCAGG + Intronic
1019398627 7:837273-837295 GACCGCTGCTCAGAGTGTGACGG - Intronic
1023864992 7:44234310-44234332 TGCCGCTGGTCAGAGGGGGCCGG - Intronic
1024089115 7:45921092-45921114 GGCCGCTGCGCTGACTCTGCTGG - Exonic
1024281308 7:47721905-47721927 GGCCACTGGTCAGAGTCTCCTGG + Intronic
1026522170 7:71127069-71127091 GGCCGCTGGTCTGGGGAAGCGGG - Intergenic
1035050738 7:155997870-155997892 GGCCTCTGTTCTGGGGGTGCTGG + Intergenic
1039432390 8:37535071-37535093 GGCTGCCGCTCTGAGTGAGCTGG - Intergenic
1039460570 8:37740374-37740396 GGCCGCTGGTCGAAGTCAGCAGG - Exonic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1047756960 8:127926354-127926376 GGCAGCTGGGGTGAGTGTACCGG - Intergenic
1049560689 8:143308563-143308585 GGCCGCTGGGCTTAGTGACCAGG + Intronic
1049607715 8:143537413-143537435 TCCAGCTGGTCTGAGTGGGCAGG - Intronic
1049681957 8:143923070-143923092 GGCCGCGCGGCTGAGTGTGGCGG - Exonic
1049747746 8:144270142-144270164 GGCTGCTGGCCTGAGCGGGCAGG + Intronic
1051834127 9:21315852-21315874 GGCAGCTGGGCTGAGTGTAGAGG - Intergenic
1057909459 9:99006453-99006475 TGCCCCTGGTCTGTCTGTGCTGG + Intronic
1060636479 9:125203463-125203485 GGCAGCTGCTCTGTGGGTGCTGG + Intronic
1061084037 9:128389094-128389116 GGAGGCTGGTCTGAGTGTGAAGG - Intronic
1061261339 9:129482501-129482523 GGCCGCGGGGCTGTGCGTGCCGG + Intergenic
1061987008 9:134135777-134135799 GGCCGCTGGTGTCTGTGTACAGG + Intronic
1062282725 9:135759205-135759227 GGGCGCTTGTCTGGCTGTGCCGG + Intronic
1062306367 9:135908962-135908984 GGCCACAGTTCTGACTGTGCAGG - Intergenic
1062511779 9:136910155-136910177 GGCCGCTCTCCTGAGTGGGCCGG + Intronic
1198028433 X:132731554-132731576 TGCGCCTGGCCTGAGTGTGCTGG - Intronic
1199824938 X:151489451-151489473 GGCCCCTGGTGCAAGTGTGCAGG - Intergenic