ID: 1150709662

View in Genome Browser
Species Human (GRCh38)
Location 17:67519833-67519855
Sequence GGCAAGTGGTTTTGGGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150709662_1150709667 -4 Left 1150709662 17:67519833-67519855 CCAGAACCCCAAAACCACTTGCC 0: 1
1: 0
2: 0
3: 19
4: 164
Right 1150709667 17:67519852-67519874 TGCCAAGCCAGTCAGCATTTAGG 0: 1
1: 0
2: 2
3: 19
4: 219
1150709662_1150709670 6 Left 1150709662 17:67519833-67519855 CCAGAACCCCAAAACCACTTGCC 0: 1
1: 0
2: 0
3: 19
4: 164
Right 1150709670 17:67519862-67519884 GTCAGCATTTAGGTAAGCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150709662 Original CRISPR GGCAAGTGGTTTTGGGGTTC TGG (reversed) Intronic
901002885 1:6157457-6157479 GGCAAGGGGCTTCGGGGTTGTGG - Intronic
901470785 1:9455096-9455118 GGCCAGAGGTTTAGGGGTTTTGG - Intergenic
902759788 1:18573608-18573630 GGCCAGAGGCTTTGGGCTTCAGG - Intergenic
903071462 1:20728911-20728933 TGCAAGGGGTTGGGGGGTTCAGG - Intronic
903391158 1:22964452-22964474 GGCAAGTCGGCTTGGGGGTCGGG - Intronic
904344119 1:29857012-29857034 GGGATGTGGTATTGGGATTCTGG - Intergenic
905445694 1:38027313-38027335 GGCAAGTGGGTGTGTGGTGCTGG + Intergenic
906784538 1:48603145-48603167 GGCTAGTGGTTTTAGGCTTGGGG - Intronic
911599237 1:99830436-99830458 GGGAATTGGGTTTGGGGTTTAGG - Intergenic
913095742 1:115513874-115513896 TACAATTGGGTTTGGGGTTCAGG + Intergenic
915637530 1:157196989-157197011 GGGAAGAGGTGTTGGGTTTCTGG - Intergenic
915681986 1:157590164-157590186 GGAAAGGAGTTTTGGGCTTCTGG - Intronic
916541132 1:165755575-165755597 GGCAAGAGGAGTTGGGGTTGTGG + Intronic
919455297 1:197813919-197813941 GGTAAGAGGTTGTGGGGTGCGGG + Intergenic
919893418 1:201992670-201992692 GGCAAGGGGCTTTGGGGTGTTGG - Intronic
921160558 1:212469331-212469353 GGCAAGTTATTTTGTGTTTCTGG + Intergenic
923266679 1:232320997-232321019 AGCATGGGGTTTTGGGGTACAGG - Intergenic
1065844152 10:29730916-29730938 GGCAAGATGTTTTGGGGTGCTGG + Intronic
1066476803 10:35755299-35755321 GTCATTTGGTTTTGGGGTCCTGG - Intergenic
1071094400 10:81956624-81956646 GGCAAGAGGTGATGGTGTTCAGG - Intronic
1071225802 10:83526688-83526710 GGCAAGTGGTTTTCAGGCTCTGG - Intergenic
1071724018 10:88178036-88178058 GGCAGGTGGTTCTCAGGTTCTGG + Intergenic
1074077771 10:110144589-110144611 GGCAAGTATTTTTGGGAATCAGG - Intergenic
1074102904 10:110367547-110367569 GGCAAAAAGTTTTGGGGGTCAGG + Intergenic
1075139177 10:119816164-119816186 GCCAGGTGGTTTAGGGGTTTAGG + Intronic
1075400596 10:122158912-122158934 GGCATGTGTTTATGGGGCTCTGG + Intronic
1079712719 11:23707387-23707409 GGGAAGTGGTGTTGGCATTCAGG - Intergenic
1082992584 11:59220811-59220833 GGCAAGTGGTTTTGGAGGTGAGG - Intergenic
1084520046 11:69657422-69657444 GGCAGGTGGTTCTGGGAGTCTGG + Intronic
1084683602 11:70681021-70681043 GGCAACTGGCTCTGGGGTGCTGG + Intronic
1084953466 11:72679231-72679253 GGAAGGTGGCTTTGGGATTCAGG + Intergenic
1085785583 11:79445636-79445658 GGCAAGTGGCTTGGGAGTTCTGG - Intergenic
1089816763 11:121183001-121183023 GGCAGGTGGCTCTTGGGTTCTGG + Intronic
1090363619 11:126189405-126189427 GGCAAGAAGTTTTGGGGACCAGG - Intergenic
1091251583 11:134148443-134148465 GGCAAGTGGGTTTGGGGTGAAGG + Intronic
1091375579 12:22811-22833 GGCAAGTTATTTTGGGGGCCTGG + Intergenic
1093138917 12:15484331-15484353 GGCAAGTGATTTTGCCATTCTGG - Intronic
1093730773 12:22563375-22563397 CTGAATTGGTTTTGGGGTTCTGG + Intergenic
1094423320 12:30295183-30295205 GTCCAGTGGTTCTGGGGATCTGG - Intergenic
1095607347 12:44085442-44085464 GGCTAGTGGTTCTGGGGCTCTGG + Intronic
1100481516 12:94983994-94984016 GGCAAGCTGGTTTGGGGTGCTGG + Intronic
1107764505 13:43719706-43719728 GGCCAGTCTTTTTAGGGTTCTGG - Intronic
1108072435 13:46641968-46641990 AGGACGTGGTTCTGGGGTTCCGG + Intronic
1110204883 13:72900704-72900726 TGCAATTGCTTTTGGGTTTCTGG - Intronic
1111347084 13:86972849-86972871 GGCCAGTGGCTTGGGGGTTGGGG + Intergenic
1114794110 14:25692985-25693007 AGCAAATGGTTTTGGAGTTCCGG + Intergenic
1119298573 14:73552813-73552835 GGCATGAGGTGTTGGGGGTCTGG - Intronic
1119302870 14:73585000-73585022 GGCATGAGGTGTTGGGGGTCTGG - Intergenic
1119330207 14:73787514-73787536 GGAAGGTGGTGGTGGGGTTCAGG + Intronic
1119979576 14:79064331-79064353 TGCAAGTGGTATAGAGGTTCAGG + Intronic
1121690174 14:95872637-95872659 GGGAAATGGTTTGGGGGTTGGGG - Intergenic
1123052501 14:105552570-105552592 CACTACTGGTTTTGGGGTTCTGG - Intergenic
1124588343 15:31031691-31031713 GGCAAGTGGTTTTGAGCTAAGGG - Intronic
1128048074 15:64637023-64637045 TGAAAGAGATTTTGGGGTTCTGG - Intronic
1128875468 15:71197837-71197859 AGCAAGTGGTTATAGGGTGCTGG + Intronic
1130822201 15:87507611-87507633 GGCAAGAGATTTTGGTGTTCTGG - Intergenic
1131156946 15:90081319-90081341 GGCAAGTGGGTGGGGGGGTCCGG - Exonic
1132574599 16:658669-658691 GGCAGGTGGCTTTGGCGGTCAGG + Intronic
1136844713 16:33566984-33567006 ACCAAATGGTTTTGTGGTTCTGG - Intergenic
1139673139 16:68505334-68505356 TGCAGGTGGCTTTGGGGCTCTGG - Intergenic
1140431808 16:74910519-74910541 AGCAAGTGGTGTTGGGGGTGAGG - Intronic
1140946591 16:79774147-79774169 GGTAAGTGGTTTCAAGGTTCTGG - Intergenic
1203154881 16_KI270728v1_random:1867282-1867304 ACCAAATGGTTTTGTGGTTCTGG - Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144686193 17:17227867-17227889 GGCAAGTGTCTTTGGGGTCTTGG - Exonic
1145883279 17:28366897-28366919 GGCAAGAGTTGGTGGGGTTCTGG - Intronic
1146724756 17:35148102-35148124 GGCAATAGATTTGGGGGTTCTGG + Intronic
1147462717 17:40584128-40584150 TGCAATTGCTTTTGGGGTTTTGG + Intergenic
1149853196 17:60054084-60054106 GGAAAGTGGTTTTGGAGGCCAGG + Intronic
1150127915 17:62650463-62650485 GGCAAGTTGTGTTTGGCTTCAGG - Intronic
1150709662 17:67519833-67519855 GGCAAGTGGTTTTGGGGTTCTGG - Intronic
1151786819 17:76279189-76279211 GGCAGGTGGATTTGGGGGACCGG - Intronic
1157738702 18:50073417-50073439 GCCAAGTTGTTTTGGGAATCTGG - Intronic
1158404847 18:57151861-57151883 GGGAAGCGGTTCTGGGTTTCCGG - Intergenic
1158843167 18:61410476-61410498 GTCAAATTGATTTGGGGTTCTGG - Intronic
1158880860 18:61778585-61778607 GGGCAGGGGTTTTGGGGTGCTGG + Intergenic
1161437487 19:4272652-4272674 GCCAGCTGGTTTTGGGGTGCTGG - Intergenic
1162445818 19:10721989-10722011 GCCACGTGGATTTGGCGTTCTGG + Intronic
1162457143 19:10792200-10792222 GGAAAGAGATTTTGGGGATCTGG + Intronic
1162807174 19:13144115-13144137 GGCAAATGGCTTTGGGGTCCTGG + Exonic
1164954007 19:32365370-32365392 TGCAATTGCTTTTGGGGTTTTGG + Intronic
1166800289 19:45452541-45452563 TGCAAGTGATTTTGTGGTACTGG + Intronic
925821743 2:7805491-7805513 GGCCAGTGGCTTTGGCTTTCTGG - Intergenic
925987146 2:9225757-9225779 GGGAAGTGGTTGTAGGGGTCTGG + Intronic
926157624 2:10466035-10466057 GGCAGATGGCTTTGGGGTACAGG - Intergenic
927090478 2:19706940-19706962 AGCAGGAGGTTTCGGGGTTCAGG - Intergenic
927400321 2:22703591-22703613 GGCAAGTGGGTTTCAGGTTCTGG - Intergenic
927416788 2:22888408-22888430 GGCAAGTGGGGGTGGGGATCAGG + Intergenic
928055089 2:28044536-28044558 AGCAAGTGGTTTCAAGGTTCTGG - Intronic
928091558 2:28377849-28377871 GGGGAGTGGTGTTGGGGTTTGGG + Intergenic
933981145 2:87551965-87551987 GGGAAGGGGTGTTGGGATTCAGG + Intergenic
936312688 2:111398834-111398856 GGGAAGGGGTGTTGGGATTCAGG - Intergenic
939234639 2:139475539-139475561 GGCAAGGTATTTTGAGGTTCTGG + Intergenic
945692496 2:213056324-213056346 GGCAGGTGCTTTTGTAGTTCAGG - Intronic
945819997 2:214652121-214652143 GTCAGCTGGATTTGGGGTTCAGG - Intergenic
946091248 2:217225829-217225851 GGCAAATGGTATTGTGGTTAAGG + Intergenic
946712197 2:222517714-222517736 GGCAAATGCTTTTGGGGCTCTGG - Intronic
946987281 2:225287035-225287057 GGCTAGTGTTTTGGGGGCTCTGG - Intergenic
947722881 2:232380146-232380168 GGCAGGTGGATTTGGGGCCCTGG - Intronic
947727227 2:232408227-232408249 GGCAGGTGGATTTGGGGGCCTGG - Intronic
948421621 2:237863857-237863879 GGCCTGGGGTTTTGGGATTCTGG - Intronic
1169752917 20:9013319-9013341 GGCATATGCTTTTGGAGTTCTGG + Intergenic
1170818873 20:19739346-19739368 GGGCAGTGGTTTTGTGGTCCTGG - Intergenic
1172062514 20:32196293-32196315 AGCACTTGGTTTGGGGGTTCAGG - Exonic
1172927008 20:38546998-38547020 GGCAAGGGGTTTAGGGGTTGAGG - Intronic
1173044623 20:39497682-39497704 GCATAGTGGTTTTGGGCTTCAGG + Intergenic
1174963097 20:55180233-55180255 GGCATGTGGTTTTGCTGCTCTGG + Intergenic
1175055320 20:56192519-56192541 AGAAAATGGTTCTGGGGTTCGGG + Intergenic
1175068053 20:56307026-56307048 GGCATGTGGTTGTGGGGCCCAGG + Intergenic
1177776923 21:25578278-25578300 GGCAGCTGGTTTTGGGGTGGTGG - Intergenic
1178265370 21:31137998-31138020 GGCAAGTGGACTAGGGGGTCAGG + Intronic
1178719295 21:34993987-34994009 AGCAAGTGGTTTTGGGGAAAGGG + Intronic
1179164829 21:38927238-38927260 GGAAACTGGTTTTGGACTTCTGG - Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183419273 22:37701233-37701255 GGCAACTGGGGCTGGGGTTCAGG + Intronic
1184631111 22:45780776-45780798 GGCAATTGGACTTGGGATTCTGG + Intronic
951670187 3:25172677-25172699 GACAAGAGGTTTTGGGGTTAGGG - Intergenic
952829666 3:37554218-37554240 GGCATGGGGTTATGGGGGTCAGG + Intronic
955655667 3:61242497-61242519 GACAAGGGGATTTGGGCTTCTGG - Intronic
956803155 3:72781631-72781653 GGAAATTAGTGTTGGGGTTCGGG - Intronic
957495081 3:80982178-80982200 GAAAAGTGGTTTTGAGGGTCAGG + Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
960394697 3:117121857-117121879 AGCACGTGGTTTTTGGATTCAGG - Intronic
961743034 3:129046032-129046054 GGCACGTACTCTTGGGGTTCGGG - Intergenic
961792357 3:129385302-129385324 AGAAAGTGGACTTGGGGTTCGGG + Intergenic
966034183 3:175390537-175390559 GGAAAATGGTTTTGAGCTTCGGG + Intronic
972730585 4:41790856-41790878 GATAACTGGTTTTGGGGTTCAGG - Intergenic
975322666 4:73025872-73025894 AGAAAGTGGTTTTGAGGTTTAGG + Intergenic
976485023 4:85591747-85591769 GGGAAGTGGATTTAGAGTTCTGG + Intronic
977337753 4:95719764-95719786 CTGAATTGGTTTTGGGGTTCTGG - Intergenic
979449051 4:120847561-120847583 GCTGAGTGGTTCTGGGGTTCTGG - Intronic
979770846 4:124523319-124523341 GGTAATAGGTCTTGGGGTTCTGG + Intergenic
981065318 4:140477621-140477643 TGCAAGTGGTTTGTGGTTTCTGG + Intronic
981815812 4:148829607-148829629 GGCAAGTTCTTTTTGGGCTCTGG + Intergenic
981986804 4:150866956-150866978 AGCTAGTGGTGTTGGGGGTCAGG + Intronic
987066669 5:14296643-14296665 GGTACGTGTTTTTGGGTTTCTGG + Intronic
993149812 5:84146664-84146686 AGCAAGTGGTTGTGGATTTCAGG - Intronic
993441836 5:87966549-87966571 ACCAAGTGCTTTTGGGGTCCTGG - Intergenic
999096108 5:148979376-148979398 GACAAGTGGGTCTGGGGATCGGG + Intronic
1000366355 5:160494830-160494852 GGAAAGGGGGTTTGGGGTTTAGG - Intergenic
1001123299 5:168997380-168997402 GGAAAGAGGATTTGGGGTTCTGG + Intronic
1001441149 5:171743953-171743975 GGGAACTGGAATTGGGGTTCAGG - Intergenic
1001535713 5:172496632-172496654 GCCAAGTGGCTTCAGGGTTCTGG - Intergenic
1001789451 5:174443396-174443418 GGAAAGTGATTTGGGGGTCCTGG + Intergenic
1002474925 5:179459545-179459567 GGCAAGTGGTCCTGGGGGTGCGG - Intergenic
1004675793 6:17841056-17841078 GAAAAGGGGTTTTGGGCTTCTGG - Intronic
1006030755 6:31175152-31175174 GGCAAGTGGCTTAGGGTTCCAGG + Intronic
1006096245 6:31658572-31658594 GGCAAGTGGATTAGGGGGTCTGG - Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006832531 6:36977507-36977529 GGGAAGTGGTAGTGGGGTTGGGG - Intronic
1007903880 6:45439365-45439387 GGCTAGTGGTTATGGAGTGCAGG + Intronic
1012506373 6:99951134-99951156 GGAAAGTGGTGTTGGGGTGAGGG + Intronic
1013663852 6:112326605-112326627 AGGAAGGGGTTTAGGGGTTCAGG - Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1015042912 6:128743064-128743086 GGCAAGCGCTTTTGGGCTCCAGG - Intergenic
1017959351 6:159208289-159208311 GGCAACTGGTATTGGTCTTCTGG + Intronic
1018033408 6:159862322-159862344 GGCTTGTGGCTTTGGGGTCCTGG + Intergenic
1018877939 6:167842193-167842215 GGCAACTGGTTTTGGTAATCAGG - Intronic
1019196968 6:170288694-170288716 GGAAAGCAGTTTTGGGGTTTGGG + Intronic
1022283836 7:28936294-28936316 GGCAAGAGATTTTGGAGTGCCGG - Intergenic
1022289075 7:28983982-28984004 TGCAAGTGGTTTAGGTGTTCTGG + Intergenic
1022374574 7:29801622-29801644 GGCAAGTGCTTTTGGGCTCTGGG - Intergenic
1022656134 7:32320864-32320886 GTCAAGTGGTCGTGGGTTTCAGG - Intergenic
1024338288 7:48231577-48231599 GGCAGGTAGTTCTGGGGTTCAGG + Intronic
1025126676 7:56350326-56350348 GGCAGATGGGTTTGTGGTTCAGG - Intergenic
1029635020 7:101777889-101777911 GGCAAGGGTATTTGGGGATCAGG - Intergenic
1031117151 7:117680902-117680924 GGCAAATGGCTCAGGGGTTCTGG + Intronic
1032799525 7:135307153-135307175 TGCAAGTGTTTTTAGGGGTCAGG - Intergenic
1033801740 7:144909576-144909598 GGCAGGTTCTTTTGCGGTTCTGG - Intergenic
1036465372 8:8992437-8992459 GGCAAGTCGTTATGTGGCTCTGG + Intergenic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043658423 8:82703404-82703426 GGCAAGTGTATTTGGGCATCTGG - Intergenic
1045295016 8:100864904-100864926 GGCAAGTGCTTTGGGAGTTGAGG + Intergenic
1047204834 8:122794767-122794789 GGACAGTGCATTTGGGGTTCAGG - Intronic
1049130849 8:140839172-140839194 GGAAACTGTTTTTGGGTTTCTGG + Intronic
1053400946 9:37821719-37821741 TGCAATTGCTTTTGGGGTTTTGG - Intronic
1055538355 9:77273649-77273671 GAAAAGAGGTTTTGGGCTTCAGG + Intronic
1061724684 9:132575644-132575666 GGGAAGGGGTTTTGGGGGGCAGG - Intergenic
1192048609 X:67702415-67702437 GACAAGTTATTGTGGGGTTCAGG + Intronic
1194744034 X:97609037-97609059 GGAAGGTGGTTTTGGGGTCCAGG - Intergenic
1194770772 X:97902034-97902056 GGCAAGTGGTGTTGGTGGTTTGG + Intergenic
1195003726 X:100666955-100666977 GGCAAGTGGATGTGGTGATCAGG + Intronic
1196469937 X:116013071-116013093 GGCCAGAGCTTTAGGGGTTCTGG - Intergenic
1197035739 X:121871003-121871025 GGCCAGTGGTGTTGGGGTGGGGG - Intergenic