ID: 1150712557

View in Genome Browser
Species Human (GRCh38)
Location 17:67544371-67544393
Sequence ATCCCTTCCCACTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150712555_1150712557 12 Left 1150712555 17:67544336-67544358 CCTTTTCTTTTCACTTCGTCGCT 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG 0: 1
1: 0
2: 1
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150712557 Original CRISPR ATCCCTTCCCACTGAAGCCC AGG Intronic
900271336 1:1790815-1790837 ATCCCGTCATTCTGAAGCCCAGG - Intronic
900745084 1:4355642-4355664 ATCCCTTCCCACTGCAGTTCAGG + Intergenic
900979342 1:6037462-6037484 AACCCTCCACTCTGAAGCCCTGG + Intronic
901187408 1:7384010-7384032 CTCCCTTCCCACTGAAACACAGG + Intronic
901744023 1:11360760-11360782 GTCCCTTCCTGCTGAAGCCCAGG - Intergenic
902981862 1:20129210-20129232 CTCCCCTCCCACTGGACCCCAGG + Intergenic
903346127 1:22685462-22685484 TTCCTTTCTCACTGAGGCCCTGG + Intergenic
903848109 1:26290481-26290503 TTCCCTCCCCTCTGAAGCTCAGG - Intronic
905458227 1:38103288-38103310 TGCCTTTCTCACTGAAGCCCAGG - Intergenic
906240048 1:44237250-44237272 ATCTCTCACCTCTGAAGCCCTGG + Intronic
907525295 1:55050416-55050438 ACCCCTTCCCAGTGTAGCACCGG + Intronic
908091212 1:60687174-60687196 CTCCCCTATCACTGAAGCCCAGG + Intergenic
909794771 1:79719462-79719484 ATCCCTTCCCACCACAGGCCCGG - Intergenic
912599988 1:110920516-110920538 CTCCCTCCCCACTTAACCCCTGG - Intergenic
913280782 1:117182894-117182916 ATTCTGACCCACTGAAGCCCAGG + Intronic
916026913 1:160841067-160841089 AGCCCTTCCCAGGGTAGCCCTGG - Intronic
916666326 1:166971087-166971109 CTCCCTTCCCACTGCAGGCTGGG + Intronic
921580135 1:216886788-216886810 ATCTCTTCTCACTGCAGCCTTGG + Intronic
922253844 1:223874497-223874519 CTCCCTTGGCTCTGAAGCCCAGG + Intergenic
922465243 1:225842137-225842159 ATACCTTCCCACTGTCTCCCAGG - Intronic
922663135 1:227447497-227447519 AGCCCTTCCCAGTCAAGTCCCGG - Intergenic
922790775 1:228309713-228309735 ACCCCTGGCCACTGAAGCCATGG + Intronic
1064089692 10:12373093-12373115 CTCATTTGCCACTGAAGCCCCGG - Intronic
1064340784 10:14483547-14483569 AACCCTTCCCACTGCAGGGCTGG - Intergenic
1068930289 10:62582401-62582423 TTCCCTTTCCACTGAAGGCAAGG + Intronic
1069903496 10:71719323-71719345 CTCCCTTCCCACTGGGGCCAGGG + Intronic
1072290881 10:93963342-93963364 ATTCCTTCCCACCCCAGCCCTGG - Intergenic
1072734986 10:97873209-97873231 TTCCCTTCACACTGAAACTCTGG - Intronic
1073476635 10:103757884-103757906 AGCTCTTCCCACTGCAGCCCAGG - Intronic
1073624828 10:105086201-105086223 AGCCCATGCCTCTGAAGCCCTGG - Intronic
1075388142 10:122072435-122072457 AACCCTCCCCACAGAAGCCTGGG - Intronic
1076372071 10:129962097-129962119 TGCCCTTGCCTCTGAAGCCCAGG + Intronic
1076429366 10:130391047-130391069 ATTCCTTCCCATGGAAGCCACGG - Intergenic
1076710702 10:132332227-132332249 GTCCCCGCCCACTGAAGCGCTGG - Exonic
1076830809 10:132993277-132993299 ATCCCTCCCTCCTGAAGCCGTGG + Intergenic
1076992888 11:284800-284822 AGCCCTGCCCTCTGAAGCCCTGG + Intronic
1078012145 11:7580577-7580599 ATCCCATCCCACACAGGCCCTGG - Intronic
1079075429 11:17382689-17382711 TTGCCTTCCCTCTGAAGCTCAGG + Intergenic
1079101450 11:17544502-17544524 GTCGCCTCCCACTGAAGCCTGGG + Intergenic
1079105527 11:17569987-17570009 ATAACTTCCCACTGCAGCCTGGG - Intronic
1079355555 11:19727473-19727495 AGCCCCTCCCACTGGTGCCCTGG - Intronic
1080706650 11:34701591-34701613 ATCCCCTACTACTGAAGCCTAGG + Intergenic
1083159518 11:60846274-60846296 AGGCCTTGCCACTGAAGGCCTGG - Intronic
1083955062 11:65978466-65978488 TCCCCTTCCCACTGCACCCCAGG + Intronic
1089060389 11:115621598-115621620 ATCCTTTCCCACAGTAGCCCAGG + Intergenic
1089619441 11:119713954-119713976 ATCCCTTGCCCCCAAAGCCCAGG - Intronic
1093139269 12:15488854-15488876 ACCCCTTCCCTCTGAAGGGCAGG - Intronic
1094630395 12:32168451-32168473 ATCCTTTTCCCATGAAGCCCGGG - Intronic
1096648465 12:53050406-53050428 ATCCCCTCACACTACAGCCCTGG - Intronic
1096842659 12:54389117-54389139 ATCCTTTCCAACTGAGTCCCTGG - Intronic
1098737747 12:74127995-74128017 ATCCCTTCACCCTGAATTCCAGG - Intergenic
1099049641 12:77767501-77767523 ATCCCTTGCCACTCCATCCCTGG - Intergenic
1101036690 12:100714875-100714897 ACCCCTTCCCACTGCAGACCAGG + Intergenic
1103587235 12:121965070-121965092 ATTCCTTCCCAATTAAGCCATGG - Intronic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1104229871 12:126874401-126874423 AGCTCTTCCCTCTGCAGCCCTGG - Intergenic
1111301605 13:86357881-86357903 ATGTCTGTCCACTGAAGCCCTGG + Intergenic
1112047024 13:95608112-95608134 GTCCCTTCCGAGTGAGGCCCTGG - Intronic
1112478938 13:99756143-99756165 ATCCCCACCCACTGAATCCATGG - Intronic
1116998254 14:51346784-51346806 AGCCCTTCCCACTGCAGGCCTGG + Intergenic
1119379116 14:74217691-74217713 ATCCCTCCCCTCTGATGCCTTGG + Intergenic
1119775096 14:77243262-77243284 CTCCCTTCCCACTCTAGCCCTGG - Intronic
1119785514 14:77310710-77310732 ATCCCTCCCCACTTAATCACAGG + Intronic
1120429153 14:84392344-84392366 ATCCCCTGTCACAGAAGCCCTGG + Intergenic
1122286564 14:100655863-100655885 ATCCCTGCCATCTGGAGCCCAGG - Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1202852430 14_GL000225v1_random:30094-30116 CACCCTCCCCACGGAAGCCCGGG + Intergenic
1202859663 14_GL000225v1_random:73180-73202 CACCCTCCCCACGGAAGCCCGGG - Intergenic
1125227155 15:37408366-37408388 ATCCCACCCCCATGAAGCCCAGG + Intergenic
1125472988 15:40022662-40022684 CTGCCTTCACACTGAGGCCCGGG + Intronic
1125502304 15:40247413-40247435 AGCCCTTCCCAGGGTAGCCCAGG + Intronic
1125591668 15:40858035-40858057 CTCCCTCCCAACAGAAGCCCTGG + Exonic
1130285554 15:82551560-82551582 ATCCCTTCCTGCTAAACCCCTGG + Intronic
1131709131 15:95033766-95033788 AGCCCTTGCCACTGCAGCCTGGG - Intergenic
1132224732 15:100131739-100131761 AAACCTTTCCACTGAGGCCCAGG + Intronic
1132356393 15:101174299-101174321 ATCCCTTCCCCCTGAATCTCTGG - Intergenic
1132825732 16:1904273-1904295 AGCCATTCCCTCTGTAGCCCCGG - Intergenic
1133270052 16:4606737-4606759 AGCCCTCCCCACTGAATCCAAGG - Intergenic
1133981139 16:10634096-10634118 CTCCCTGCCCAGTGAAGCCCTGG + Intronic
1134248431 16:12557191-12557213 AGCCTTTCCCTCTGGAGCCCTGG - Intronic
1135565177 16:23506477-23506499 ATCCCATCCCACTCAACCCTGGG + Intronic
1135939776 16:26811184-26811206 CTCTCTTCCCCCTGCAGCCCCGG + Intergenic
1137350683 16:47711731-47711753 GTCCTTTCCCACTGGAGACCTGG - Intergenic
1143012938 17:3876219-3876241 TCACCTTCCCACTGAAGCTCTGG + Exonic
1145779668 17:27553913-27553935 AGCCCTTGCAGCTGAAGCCCTGG - Intronic
1146599615 17:34203386-34203408 ATCACTTCCCGTTAAAGCCCAGG - Intergenic
1147872658 17:43598453-43598475 AGACCTGGCCACTGAAGCCCAGG + Intergenic
1149286521 17:55171529-55171551 ATACCTCCCCATTGAAGCCTAGG + Intergenic
1150577983 17:66446765-66446787 ATCCTCTTCCACTGCAGCCCAGG - Intronic
1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG + Intronic
1151355174 17:73553926-73553948 AACACATCCCCCTGAAGCCCTGG + Intronic
1155593215 18:27452449-27452471 TCCCCTTCCCACTGTATCCCAGG - Intergenic
1156041605 18:32829223-32829245 ATCCATTCCCTCTGAAGCACAGG - Intergenic
1160931569 19:1572761-1572783 ATCCCTTCACTCTGTCGCCCAGG + Intergenic
1161038693 19:2098820-2098842 ACCCCCTCCCCCTGAAGTCCAGG - Intronic
1162080625 19:8215636-8215658 ATTCCCTCCCAGTGAAGCCCAGG - Intronic
1163035727 19:14567822-14567844 CTCTCATCCCACTGAGGCCCAGG + Intronic
1163310773 19:16513216-16513238 ATCCCTGCCCAATGGACCCCTGG - Intronic
1164457861 19:28423531-28423553 ATCCCATCACAGTGAATCCCAGG + Intergenic
1164588171 19:29490627-29490649 CTCCCTTCCCACTGAGGTCTGGG + Intergenic
1164630676 19:29759670-29759692 AGCCCTCCCCACCGAAGTCCCGG - Intergenic
1164775463 19:30850109-30850131 ATCCCTGCCCCCTGAAGGCCTGG - Intergenic
1165758355 19:38307081-38307103 AGCCCTTCCCACTGGAGTCAGGG - Intronic
1166259125 19:41625875-41625897 ATCCTTTCCCTCTGCAGCACTGG + Exonic
1166485315 19:43206865-43206887 CTGCCTGCCCACTGCAGCCCAGG - Intronic
1166516303 19:43449561-43449583 ATCCCTTCCCAGTCAGTCCCTGG - Intergenic
1167157724 19:47749711-47749733 ATCAGTTGACACTGAAGCCCAGG - Intronic
1168286448 19:55337074-55337096 GTCCCTCCCCACTGATGACCAGG + Intergenic
926062321 2:9812281-9812303 AACCCTTCCCAGTGCTGCCCTGG + Intergenic
926196429 2:10766157-10766179 ACCACTTCCCAAGGAAGCCCTGG + Intronic
927200356 2:20574561-20574583 ATTCCTTCCCAGTGATCCCCTGG - Intronic
928072151 2:28227710-28227732 ACCCCTTCCCATTCCAGCCCTGG + Intronic
929070866 2:38029327-38029349 CTCCCTTCCCACTCAAGGCCTGG + Intronic
929217638 2:39432875-39432897 AGCCATTCCCTCTGAAGCACGGG - Intronic
930114976 2:47710642-47710664 CTCCCTTCCCACTGATCTCCTGG - Intronic
930872975 2:56185530-56185552 TCCCCTTCCCACTTAACCCCAGG + Intronic
931721751 2:65072010-65072032 ATACTTACCCACTGAGGCCCGGG + Exonic
932751619 2:74374929-74374951 GTCCCTCCCCAGTGATGCCCTGG - Intronic
935736147 2:106107962-106107984 ACGCCTTTCCACTGCAGCCCAGG - Intronic
936684006 2:114806036-114806058 ATCCCCTCCCACCTATGCCCAGG + Intronic
938955141 2:136290453-136290475 ATCCCTGCCCACTGATGTTCAGG - Intergenic
938972856 2:136448275-136448297 TTCCCTTCCCCCTGGAGCACTGG + Intergenic
939258911 2:139781648-139781670 TTCCCTTCCTACTGAAACTCGGG - Intergenic
941323948 2:164089460-164089482 ATCCCTTCCCACTGCCACCGAGG - Intergenic
946074833 2:217065140-217065162 TTCCTTTCCCAGTGAGGCCCAGG + Intergenic
946993694 2:225366029-225366051 CTCCCTTCCCCCTAAACCCCTGG + Intergenic
947398697 2:229712475-229712497 ATCCATTCCCACTAAACCCTAGG + Intronic
947500081 2:230665216-230665238 GGCCCTTCCCCCTGGAGCCCTGG + Intergenic
947642607 2:231715366-231715388 ATGACCTCCCACTGGAGCCCAGG + Intergenic
948216930 2:236239093-236239115 TGCCCTTCCCAGTGAAGACCAGG + Intronic
948482187 2:238257205-238257227 ATCCCATCCCACAGATGCTCTGG + Intronic
948487518 2:238290183-238290205 AGCCCTTCCCACAGAAGCCCCGG + Intergenic
948602591 2:239115861-239115883 CTCCCTTCCTGCTGAATCCCAGG + Intronic
948680615 2:239632062-239632084 ATCCTTTCCCACTGAAGGGAAGG + Intergenic
1169313949 20:4572374-4572396 ATTCCTTCCCACTGAAGTTGGGG - Intergenic
1171185947 20:23124276-23124298 ATCCATCTCCACTGTAGCCCAGG + Intergenic
1174064515 20:47854824-47854846 AACCCTTCCCACTGTGCCCCCGG - Intergenic
1174569588 20:51492221-51492243 ATCCATTCACTCTGAGGCCCTGG - Intronic
1175381319 20:58566324-58566346 ATGCCTTCCCGCTGCAGCCATGG - Intergenic
1175447313 20:59032191-59032213 AGCCCTTCCCTCTGGAGGCCTGG + Intronic
1178434099 21:32542138-32542160 ATCTCTGGCCACTGAAGCCCAGG + Intergenic
1179420986 21:41236650-41236672 AGCCCTACCTGCTGAAGCCCAGG - Intronic
1179615271 21:42579537-42579559 AGCCCTGCCCACAGGAGCCCAGG + Intronic
1181052026 22:20242394-20242416 AGCGCTGCCCACTGAGGCCCTGG - Exonic
1182599022 22:31445209-31445231 CTCCCTGCCCAGTGAAGCACAGG - Intronic
1183427720 22:37748368-37748390 ATCCCAACTCCCTGAAGCCCCGG - Intronic
1184126223 22:42489196-42489218 ATCCCAGCCCACTGCAGCCTCGG - Intergenic
1185297540 22:50061798-50061820 ATCTCTTTCCACAGAGGCCCAGG - Intronic
950556805 3:13701006-13701028 AGCCCCTGTCACTGAAGCCCTGG - Intergenic
950869838 3:16219250-16219272 GACCCTCCCCACTGCAGCCCTGG + Intronic
951467712 3:23020228-23020250 ATCCCTGCACACTGGAGGCCTGG + Intergenic
951613537 3:24519185-24519207 AACCCTTCCTACAGAACCCCTGG + Intergenic
957760339 3:84548136-84548158 CTCCCTTCCCACTGCAGAGCAGG - Intergenic
961143594 3:124575766-124575788 AACCTTTCCCACTGTGGCCCAGG - Intronic
961547706 3:127646854-127646876 ATCCCTGAGCACTGATGCCCTGG + Intronic
961835309 3:129653322-129653344 ATCCCTTTCCACTGATGTCAGGG - Intronic
962958488 3:140288380-140288402 TTCCTTTCACACTGATGCCCTGG + Intronic
964607000 3:158570989-158571011 ATCCCATCCCACAGGAGCCTTGG + Intergenic
968229628 3:196997646-196997668 CACCCTTCCCACCCAAGCCCTGG + Intronic
968576446 4:1368520-1368542 TCCCCTCCCCACTGAAGCCCAGG + Intronic
973634837 4:52852278-52852300 CTCCCTCCCCACTCCAGCCCCGG + Intergenic
975103685 4:70543986-70544008 CTCCCTTCCCCCTGAACCTCTGG - Intergenic
976382867 4:84420188-84420210 ACCCCTTCTCACTGAGGTCCTGG + Intergenic
976481816 4:85555571-85555593 ATCCTCTCCCACTCAAGTCCTGG + Intronic
978042354 4:104083798-104083820 TTCCCCTCCCCCTGAACCCCTGG + Intergenic
982428588 4:155296305-155296327 ATACTTCCCCACTGAAACCCTGG + Intergenic
987990962 5:25212349-25212371 ATGCCTTCCCTCTGAAGATCTGG - Intergenic
990809702 5:59709167-59709189 AGCCCTTTCCCCTGCAGCCCCGG + Intronic
992575763 5:78110024-78110046 ATCCCTTGCCACTGAAATCAAGG - Intronic
993105069 5:83591072-83591094 AGACATTCCCACTGATGCCCTGG - Intergenic
993105250 5:83592913-83592935 AGACATTCCCACTGATGCCCTGG - Intergenic
993810326 5:92468177-92468199 CTGGCCTCCCACTGAAGCCCTGG - Intergenic
995354061 5:111217573-111217595 ATTCCCTCCCACTTTAGCCCTGG + Intergenic
997649686 5:135507127-135507149 ATTCATTCCAACTGAGGCCCCGG - Intergenic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
998547473 5:143042624-143042646 ATTCCTCCCCATGGAAGCCCTGG + Intronic
1000463402 5:161548156-161548178 TTCCCTTCCTCCTGAAGCTCAGG + Intronic
1001382925 5:171315726-171315748 ATCCGTTCCCAGTCCAGCCCCGG + Intergenic
1002185497 5:177452918-177452940 ATCCCTTCCCACCAGGGCCCTGG - Intronic
1002260155 5:177987652-177987674 ACCCATTCCCTCTGAAGCACGGG + Intergenic
1003119280 6:3306673-3306695 CGTCCTTCCCACAGAAGCCCTGG - Intronic
1003500321 6:6697666-6697688 ATCCCTTTCCCTTGAAGCCTGGG - Intergenic
1004096510 6:12560285-12560307 AGCCCTGCCCACTGGAGGCCTGG + Intergenic
1004188278 6:13441122-13441144 AGCCCTTCCCACAGAAGCTAGGG + Intronic
1004321037 6:14631693-14631715 GCACCTTCCCTCTGAAGCCCAGG + Intergenic
1006386060 6:33731640-33731662 AGCCCTTCCCTCTGAAGTCGGGG + Intronic
1011750434 6:90449755-90449777 ATCACTGCATACTGAAGCCCTGG + Intergenic
1015106572 6:129543801-129543823 ATCCCTTCCCAGCCAACCCCTGG + Intergenic
1016729898 6:147417887-147417909 ATAGCTTCCAAATGAAGCCCAGG - Intergenic
1018172849 6:161155222-161155244 CGTCCATCCCACTGAAGCCCTGG - Intronic
1018721526 6:166576876-166576898 ATCCCCTCCCATTGCAGGCCTGG + Intronic
1021361523 7:19718827-19718849 ATCTCTACCCACTAAATCCCAGG - Intergenic
1023300360 7:38764225-38764247 AACCATGCCCACTAAAGCCCTGG + Intronic
1024924642 7:54600001-54600023 ATCCTTTTCCAGAGAAGCCCTGG - Intergenic
1025753441 7:64312710-64312732 AGCTCTTCCCTCTGAATCCCTGG + Intronic
1029365209 7:100112195-100112217 CCCCCTTGCGACTGAAGCCCCGG - Exonic
1033549911 7:142437851-142437873 ATCTTTTCCTACTTAAGCCCAGG + Intergenic
1034965227 7:155386723-155386745 AGCCCCTCCCTCTGCAGCCCTGG + Intronic
1035769133 8:2132949-2132971 AGCCCTTCCCACTGTAGACATGG - Intronic
1037187032 8:16076862-16076884 ATCCATTCACACTGGATCCCAGG - Intergenic
1037605692 8:20435523-20435545 ATCTCTTGCCACGGAAGGCCTGG + Intergenic
1037911747 8:22747825-22747847 AAGCCTTCCCACAGAGGCCCCGG + Intronic
1038452137 8:27646605-27646627 ATACCTCCCCACGGTAGCCCCGG + Intronic
1038575058 8:28698044-28698066 ATCCCTTAACACTGAAATCCTGG - Intronic
1038581311 8:28751547-28751569 TTCTCTTCCCAGTGAATCCCTGG + Exonic
1039422062 8:37451469-37451491 AACCTTTCCCACTGATCCCCAGG + Intergenic
1040976051 8:53195493-53195515 ATCCCTTCTCTCTGAAGAACTGG + Intergenic
1041392488 8:57359481-57359503 AGCCCTTCCCATTGTAGACCTGG + Intergenic
1042642979 8:70955749-70955771 ATCCCTTGCCACTGCACACCTGG - Intergenic
1045182963 8:99805975-99805997 ATCCCTTCTGCCTGAAGCCCAGG - Intronic
1045918477 8:107501981-107502003 GTCCCTTTCCTCTGAAACCCAGG + Intergenic
1048055082 8:130855523-130855545 GTCTCTTCCCCCTGAACCCCAGG + Intronic
1048199458 8:132359817-132359839 ATCCCTTTCCCAGGAAGCCCAGG + Intronic
1049254838 8:141608306-141608328 TTCCCTTCCCACTGTTGTCCAGG + Intergenic
1049671972 8:143873923-143873945 ACCCCAGCCCTCTGAAGCCCTGG + Intronic
1049851977 8:144837519-144837541 ATCCCATCGCAGAGAAGCCCTGG + Intronic
1053035903 9:34826537-34826559 ATACCTGCTCACTGCAGCCCAGG - Intergenic
1057879484 9:98782280-98782302 TTCCCTCCCCAGTGAAGCGCTGG - Intronic
1058351282 9:104027639-104027661 ATCTCTTCTCACTGAAGAACTGG - Intergenic
1060062383 9:120472443-120472465 CTCCCTTTCTTCTGAAGCCCGGG - Intronic
1061411291 9:130423286-130423308 CTCCCTTCCCAAGGAATCCCTGG + Intronic
1061627235 9:131848275-131848297 ACCCCTCCCCACTGCACCCCAGG - Intergenic
1061789550 9:133051868-133051890 ATCCCTTCCCTCAGAAGCCTGGG - Intronic
1061907164 9:133704673-133704695 AGCCCTTCCCACTTAGGCCATGG + Intronic
1062145624 9:134988205-134988227 TTCTCTTCCCACCAAAGCCCGGG + Intergenic
1185745221 X:2567167-2567189 ATCCCTCCACACTGGAGTCCTGG + Intergenic
1187427472 X:19191393-19191415 ATGCTCTCCCAGTGAAGCCCTGG - Intergenic
1188073614 X:25748412-25748434 ATCCCTTTCCTCTGAATACCGGG + Intergenic
1188152447 X:26694819-26694841 AGCCCTGCCCAGTGAAGCCTGGG - Intergenic
1189365091 X:40381790-40381812 CTCCCTCCCCACTGAACCCATGG + Intergenic
1190829471 X:54046979-54047001 GTCCCTTTCCACTGAGGGCCTGG - Intronic
1192909079 X:75584051-75584073 TTCCTTTCTCACTGAAGTCCTGG - Intergenic
1194786385 X:98089308-98089330 AGACCTTCCCACAAAAGCCCAGG - Intergenic
1195034349 X:100958009-100958031 ATCCTTTTCCACTGAAGCAGAGG + Intergenic
1195901760 X:109805646-109805668 ACCCCTTCCCTCTGTACCCCAGG - Intergenic
1197004494 X:121480353-121480375 AGCCCCTCCCACCAAAGCCCTGG + Intergenic
1200246250 X:154527648-154527670 ATCCCTTCACACTGAGTCCCAGG - Intergenic
1200685191 Y:6251808-6251830 ATCTCAGCCCACTGCAGCCCAGG + Intergenic
1200990717 Y:9343078-9343100 ATCTCAGCCCACTGCAGCCCAGG + Intergenic
1200993377 Y:9363392-9363414 ATCTCAGCCCACTGCAGCCCAGG + Intronic
1200996039 Y:9383666-9383688 ATCTCAGCCCACTGCAGCCCAGG + Intergenic
1201001210 Y:9472545-9472567 ATCTCAGCCCACTGCAGCCCAGG + Intronic
1201003874 Y:9492876-9492898 ATCTCAGCCCACTGCAGCCCAGG + Intergenic
1201006528 Y:9513157-9513179 ATCTCAGCCCACTGCAGCCCAGG + Intergenic
1201009184 Y:9533463-9533485 ATCTCAGCCCACTGCAGCCCAGG + Intergenic