ID: 1150712560

View in Genome Browser
Species Human (GRCh38)
Location 17:67544374-67544396
Sequence CCTTCCCACTGAAGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150712555_1150712560 15 Left 1150712555 17:67544336-67544358 CCTTTTCTTTTCACTTCGTCGCT 0: 1
1: 0
2: 1
3: 11
4: 250
Right 1150712560 17:67544374-67544396 CCTTCCCACTGAAGCCCAGGAGG 0: 1
1: 1
2: 1
3: 20
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150712560 Original CRISPR CCTTCCCACTGAAGCCCAGG AGG Intronic
900362122 1:2294170-2294192 CCCTCCCACTGGTGCCCATGGGG + Intronic
900680041 1:3911653-3911675 CCCACCCACTGAGACCCAGGAGG + Intergenic
900790201 1:4675016-4675038 CCTTTGCCATGAAGCCCAGGAGG + Intronic
900826508 1:4931372-4931394 CCTTCACAGTGAAGCCCCAGAGG - Intergenic
901794209 1:11671190-11671212 CCTCCCCACTTAGTCCCAGGAGG - Intronic
903267311 1:22165541-22165563 CCTCCCCACAGAAGCCCAAATGG - Intergenic
903555109 1:24187383-24187405 CCTTCTCAGTGAATCCTAGGCGG - Intronic
903705524 1:25282771-25282793 GGTTCCCACTGAAGCACAGGAGG + Intronic
903721706 1:25410549-25410571 GGTTCCCACTGAAGCACAGGAGG - Intronic
904300151 1:29549018-29549040 CCTCCCCAGTGAGGACCAGGAGG - Intergenic
904538188 1:31215200-31215222 CCTTCCGACTAAAAGCCAGGTGG + Intronic
905224665 1:36471502-36471524 CCTGCCTTCAGAAGCCCAGGAGG - Exonic
907562001 1:55399667-55399689 CCTCCCCACTGGAGCCCATGGGG - Intergenic
908521001 1:64941926-64941948 CCTACCGACTGGAGCCCAGTCGG + Intronic
908621260 1:65982949-65982971 CCTGCCCTCTGAAACCAAGGAGG - Intronic
909085756 1:71168543-71168565 CCTTTCTACTGAAGTCCAAGAGG + Intergenic
910934682 1:92478187-92478209 CCCTCCCACAAAAGGCCAGGTGG + Intronic
912493974 1:110079488-110079510 CCCTCCCACTGATGCCAATGTGG - Intergenic
912694823 1:111833390-111833412 CTTTCCCAATGAAGCCCATAGGG + Intronic
913553568 1:119940563-119940585 TTTTCCCAGTGTAGCCCAGGGGG + Exonic
918926861 1:190797519-190797541 CCTGCCCACTGTGGCCCTGGAGG + Intergenic
923273637 1:232378839-232378861 CCTTCCCTGGGAAGCCCAGCAGG - Intergenic
923624859 1:235605788-235605810 CCTTATTCCTGAAGCCCAGGAGG + Intronic
923683936 1:236141615-236141637 ACTTCTCTCTGAAGCCCAGTGGG + Intergenic
1062931337 10:1354645-1354667 CCATCCCAAGGATGCCCAGGAGG - Intronic
1063347137 10:5322568-5322590 CGTTCTCACTGGAACCCAGGAGG + Intergenic
1064256611 10:13747758-13747780 CCTTCCCACCCAAGCCCTGAAGG - Exonic
1064585175 10:16832915-16832937 CCTTCCCACTGAGAGCCAGATGG + Intronic
1066064123 10:31750107-31750129 CCTCTCCCCTGAAGCCCAGCCGG - Intergenic
1066216395 10:33292552-33292574 CCTTGACACTGAAGCCCAGCAGG + Intronic
1070850328 10:79558020-79558042 CCTACCCCGTGAGGCCCAGGGGG + Intronic
1070856890 10:79613276-79613298 CCTACCCCGTGAGGCCCAGGGGG - Intronic
1071272345 10:84019795-84019817 CCTCACCAAGGAAGCCCAGGGGG + Intergenic
1071951044 10:90702866-90702888 CCTTCCCAGTGTAGGCCAGTAGG + Intergenic
1072277012 10:93833475-93833497 CCTTCACACAGAATCCCAGTTGG - Intergenic
1073202323 10:101745730-101745752 CCTTCACACTGAGTCCCATGAGG - Intergenic
1073431876 10:103492441-103492463 GCTTCCCACTGTGGGCCAGGAGG - Intergenic
1073697656 10:105889072-105889094 CACTCCCACTGAAGCTCTGGGGG - Intergenic
1074153926 10:110782156-110782178 CCTTCTCTCTGCAACCCAGGTGG - Intronic
1076380011 10:130018464-130018486 CCTTCCCCCTGCAGCCCAGCTGG + Intergenic
1076590992 10:131581913-131581935 CCTTCCCTGGGAAGCACAGGGGG - Intergenic
1076890055 10:133279006-133279028 GCTGCCCACTGTAGCCCTGGAGG + Exonic
1077798596 11:5516436-5516458 CCCACCCACTAAAGCCCATGTGG - Exonic
1078879212 11:15431599-15431621 TCTGGCCACTGAACCCCAGGGGG + Intergenic
1080578171 11:33618698-33618720 CCTTTCCCCTGAAGGCAAGGGGG + Intronic
1082789904 11:57339906-57339928 CCTGCCCACTGAAGCCTACCAGG - Intronic
1083367282 11:62148850-62148872 CCTCTCCACTGGGGCCCAGGTGG - Intronic
1083466881 11:62853560-62853582 CCTTCTCTCTAAAGCCCAAGAGG - Intergenic
1083584014 11:63843415-63843437 CCTTCCCACTGCAGCAGAAGTGG - Intronic
1083628996 11:64086182-64086204 CCTCCCCACTCCAGCCCTGGGGG - Intronic
1085234625 11:75004794-75004816 CCTTCCCAGTGTAGTACAGGAGG + Intronic
1089474111 11:118744436-118744458 CCTTCCCACTGATTTCCTGGGGG + Intergenic
1089765159 11:120757793-120757815 CCTGCCCTCCGAAGCCCAGAGGG - Intronic
1091267332 11:134281655-134281677 CCTCTCCACTGCAGCCCAGAGGG + Intronic
1091275092 11:134344664-134344686 CCTCTCCACTGCAGCCCAGAGGG + Intronic
1091821816 12:3481142-3481164 CCTTCCCAGGGAAACCCAGAGGG + Intronic
1091851798 12:3705576-3705598 CCCTCCCACTGAAGCCTGGGTGG - Intronic
1092728641 12:11508256-11508278 CCTTCCCACTGCGGGGCAGGTGG - Intergenic
1095894223 12:47264405-47264427 CCTTCCCTCTGGAGGCCTGGAGG + Intergenic
1096218024 12:49809167-49809189 CCTTCCCCCTTAAAGCCAGGAGG + Intronic
1096464569 12:51841150-51841172 CCTGCCCACTCACACCCAGGTGG - Intergenic
1096466466 12:51849451-51849473 CCTGCCCTCTGCAGCCCGGGAGG - Intergenic
1097065104 12:56315239-56315261 TATTCCCACTCAAACCCAGGTGG - Exonic
1100849600 12:98695713-98695735 CCTTCACTCTGCAACCCAGGGGG - Intronic
1102005287 12:109585829-109585851 CCTTCCCTCTGAAGCCCACCTGG - Intronic
1103413222 12:120727138-120727160 GTTTCCCATTGCAGCCCAGGTGG + Exonic
1103950724 12:124549626-124549648 ACTCCCCACTGCAACCCAGGAGG + Intronic
1104070270 12:125338626-125338648 TCTGCCCACTGGAGCCCAGAGGG - Intronic
1104676872 12:130717026-130717048 CCTTCCCACAGAACTTCAGGTGG + Intergenic
1104799229 12:131542253-131542275 CCTTCCTCCAGAAGCCCACGAGG - Intergenic
1104953293 12:132451901-132451923 CCCTCCCACTGCAGCCAGGGTGG - Intergenic
1106982317 13:35302036-35302058 CCTCCCTACTGCAGCCCATGAGG - Intronic
1110166174 13:72446313-72446335 CCCTCCCTCTGATGCCCAGCTGG + Intergenic
1113362841 13:109647094-109647116 CCTTCCCTGTGAAGCTTAGGGGG - Intergenic
1113640497 13:111953721-111953743 CCCTCCCACTGACGGCCATGAGG - Intergenic
1113902987 13:113806769-113806791 ACTTCCCACGGGAGACCAGGAGG - Intronic
1114615935 14:24068495-24068517 TCTCTCCACTGAAGCCCTGGAGG - Intronic
1118988274 14:70775773-70775795 CCTTTCCACTAGAACCCAGGAGG + Intronic
1120131982 14:80818648-80818670 CTTTCTCCCTGAAGCCCAGCAGG + Intronic
1121691571 14:95881362-95881384 ACCTCCCACAGAACCCCAGGGGG - Intergenic
1122537555 14:102476532-102476554 CATCCACACTGAAGCCCAGAGGG + Intronic
1122817341 14:104320186-104320208 CCTTCCCCAGGCAGCCCAGGAGG + Intergenic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1127474979 15:59324600-59324622 TCTTCTCCCTGAAACCCAGGTGG + Intronic
1127856522 15:62958132-62958154 AATTTCCACTGGAGCCCAGGGGG - Intergenic
1128344972 15:66847899-66847921 GCTTCCCCCTCGAGCCCAGGTGG + Intergenic
1128501762 15:68231564-68231586 CCCTCCCTCTGGAGCCCAGCAGG - Intronic
1128732614 15:70031349-70031371 CCTTGCCAGTGAAGTCCAGATGG + Intergenic
1132356390 15:101174296-101174318 CCTTCCCCCTGAATCTCTGGAGG - Intergenic
1136175825 16:28515571-28515593 TCTTACCGCTTAAGCCCAGGAGG - Intergenic
1136522478 16:30805878-30805900 TTTTCCCAGTAAAGCCCAGGCGG + Intergenic
1137585660 16:49662866-49662888 CCTTCACACTGAGCCCCACGTGG - Intronic
1140634115 16:76890304-76890326 CCTTCCCAGTGAAGCCCATTTGG + Intergenic
1140685854 16:77433784-77433806 ACTTCCCAGTGGAGCCCAGAGGG - Intronic
1140949428 16:79802126-79802148 TCTGCCCACTGAACCACAGGTGG + Intergenic
1141147670 16:81543057-81543079 CCTGCCCGCTGGAGCCCATGAGG + Intronic
1141424690 16:83937137-83937159 TCTTCCCACTGAGGAGCAGGAGG - Intronic
1141597481 16:85106288-85106310 TCTTCCCACTGGATGCCAGGTGG + Intronic
1142239557 16:88938993-88939015 CCTCCCCACTGCAGCCCTGAGGG + Intronic
1142482403 17:227144-227166 CTTCCCCACTGCAGCCCAGAAGG + Intronic
1142510462 17:389591-389613 CCTTCCCACTGTTGACCAGACGG + Intergenic
1142510494 17:389689-389711 CCTTCCCACTCTTGACCAGGCGG + Intergenic
1143136783 17:4716620-4716642 CCTGCCCTCTGAGGGCCAGGGGG + Exonic
1143671185 17:8397294-8397316 CCTTCCCCCTGCCTCCCAGGTGG - Intronic
1143768183 17:9151127-9151149 CCTTCCCCCAGAAGCCTAAGAGG + Intronic
1144167885 17:12630200-12630222 CCTGCCCACTGAAGCCGTTGTGG - Intergenic
1144171503 17:12663898-12663920 TCTTCTCATTGAAGACCAGGGGG + Intergenic
1146650175 17:34601713-34601735 TCTTCCCTCTGAAGCCCCAGAGG - Intronic
1147158569 17:38558121-38558143 CCTTCCCTCTGAGTCACAGGTGG - Intronic
1150712560 17:67544374-67544396 CCTTCCCACTGAAGCCCAGGAGG + Intronic
1151130275 17:71889610-71889632 CTGGCCCACTGAAGCCAAGGAGG + Intergenic
1151694303 17:75706261-75706283 CCTTCCCCCTGCAGGCCAGCGGG - Intronic
1152662286 17:81548085-81548107 CCTTCACAGTGAAAACCAGGGGG + Intronic
1156258555 18:35422921-35422943 CCTGCCCACTGTAGCTCATGTGG - Intergenic
1156464943 18:37342846-37342868 CCTTCACGCTGCAACCCAGGGGG - Intronic
1157327811 18:46681485-46681507 CCTTCCAGATGAACCCCAGGAGG + Intronic
1157377035 18:47176356-47176378 CCTTCCTACGGAAGCCGATGGGG + Intergenic
1159167344 18:64720790-64720812 CCTTCCCACTGAAAGCCACTTGG + Intergenic
1159439065 18:68454762-68454784 TGTTCTCACTGAACCCCAGGTGG + Intergenic
1159957058 18:74526128-74526150 GCCTCCCACTGCAGCCCTGGAGG - Intergenic
1160688411 19:448327-448349 CGCTCCCTCTGAAGCCCCGGGGG + Intronic
1160837010 19:1129581-1129603 TCATCCCACTGAGGCCCACGAGG + Intronic
1161124271 19:2547035-2547057 CCTTCCCACCTCAGCACAGGTGG + Intronic
1161469959 19:4452285-4452307 CCCTCCATCGGAAGCCCAGGTGG - Intronic
1161942948 19:7417237-7417259 CCTTCTCAGTGAAGCCCCAGAGG - Intronic
1162115059 19:8424154-8424176 CCTTCCCAGGGCAGCTCAGGAGG - Intronic
1162527468 19:11214717-11214739 CCTTCCCCTGGCAGCCCAGGGGG + Intronic
1163034003 19:14561278-14561300 CCTACCCACAGAAACCCAGCGGG - Intronic
1163346297 19:16744642-16744664 CCTACGCTCTGGAGCCCAGGAGG + Exonic
1164677788 19:30113361-30113383 CCCTCCCATGGAAGCCCAGGGGG - Intergenic
1166416181 19:42596173-42596195 CCTTCCCTCTGCACCCCAGGAGG - Intronic
1166455762 19:42938432-42938454 CCTGCCCGCTGAACCCCTGGTGG - Intronic
1166482829 19:43187728-43187750 CCTGCCTGCTGCAGCCCAGGGGG - Intronic
1166485311 19:43206862-43206884 CCTGCCCACTGCAGCCCAGGGGG - Intronic
1166492459 19:43270780-43270802 CCTGCCCCCTGCACCCCAGGGGG - Intergenic
1167250507 19:48396377-48396399 ACTCCCTACTGAGGCCCAGGAGG - Intronic
1167266357 19:48484848-48484870 CCTTCCCACCCAACCCCAGTGGG + Intergenic
1168702825 19:58451809-58451831 CCGCCCCGCGGAAGCCCAGGAGG + Intronic
925086274 2:1109990-1110012 CATTCCCACTGTAGCTCAGATGG - Intronic
925201033 2:1967968-1967990 CCTGCTCACTGCACCCCAGGAGG + Intronic
925218878 2:2121831-2121853 CTTTGCTACTGGAGCCCAGGAGG + Intronic
925325588 2:3019451-3019473 CCTTCCCACTGCGGCCCATCAGG - Intergenic
925474061 2:4192881-4192903 CCTGCCCATTGCAGACCAGGAGG - Intergenic
925987290 2:9226669-9226691 TCTTCCCTCTTAAGCCCTGGAGG + Intronic
927565088 2:24104810-24104832 CCTTGCCACTGACAGCCAGGTGG + Intronic
927942350 2:27112925-27112947 ACTTCCTGCTGAGGCCCAGGTGG - Intronic
928327707 2:30333335-30333357 CCTATCCACTGAATCCCATGTGG + Intergenic
929612779 2:43284262-43284284 CCCTCCCACCAAAGGCCAGGAGG + Intronic
929950704 2:46407530-46407552 CCCTCCCACTGATGCCCACCTGG - Intergenic
930238949 2:48916021-48916043 CCGTGCCACTGAAGCCGAAGAGG + Intergenic
930845591 2:55900266-55900288 CCTTTACAGTGAAGCCCAGAGGG - Intronic
931161960 2:59702542-59702564 CCTGCTCACTGAAGCCCTTGGGG - Intergenic
931214194 2:60226187-60226209 CCTCACCACAGAAGCTCAGGTGG + Intergenic
932568496 2:72924348-72924370 CCTTCGCACGCAAGCCCAAGCGG + Exonic
932589295 2:73054204-73054226 CCTCCCCACTGTACCCCAGTTGG - Intronic
932756591 2:74414116-74414138 CCCTCTCACTGAACCCCAAGGGG - Intergenic
932865332 2:75335521-75335543 CCTTCCAACTTAAGACCAGCTGG - Intergenic
933150036 2:78903227-78903249 TCTTTCCACTGAATCCCAGCAGG + Intergenic
934696796 2:96405895-96405917 CCTGCCCACCGAGACCCAGGAGG + Intergenic
934958439 2:98645422-98645444 TCTTACCAATGAAGCCCAGCTGG + Exonic
936479357 2:112870743-112870765 CCTTCCTACTTAAGCCCACTTGG - Intergenic
936528689 2:113259864-113259886 CCTTCCTTCTGCAGCCCAGAGGG - Intronic
936967989 2:118146201-118146223 TCTTCCTACTGAAGCCCAGAAGG + Intergenic
937244588 2:120484454-120484476 CCTACCCAGTGGAGCACAGGGGG - Intergenic
938208573 2:129444621-129444643 CCCTCCCAGTCATGCCCAGGAGG + Intergenic
939001958 2:136747022-136747044 CCTCCCCCGTGAAGGCCAGGAGG + Intergenic
939006505 2:136793894-136793916 CCTTTCCACAAAAGCCCAGAAGG - Intronic
939161090 2:138589703-138589725 CCATCCCACTCCAGCCCAGCTGG - Intergenic
940285285 2:152027538-152027560 GCTTCCCACTGGAGCCAAAGAGG - Intronic
947792848 2:232877642-232877664 CCTGGACACTGGAGCCCAGGTGG + Intronic
949041027 2:241850081-241850103 CCTTCCCACCCAGGCCCTGGTGG + Exonic
1168758831 20:334682-334704 TCTTCACACTGCAGCCCAAGGGG + Intergenic
1168831338 20:846790-846812 CTCTCCCACTGAGGCCCAGAGGG - Intronic
1168947836 20:1776573-1776595 CCTTCCCCCTGCAGACCACGGGG + Intergenic
1170665216 20:18380921-18380943 CCAGCCCACTGAAGCCCACTGGG + Intergenic
1171032836 20:21692399-21692421 CTCCCCCACTGAAGCCCACGGGG + Intergenic
1172098488 20:32472362-32472384 CAACCCCACTGATGCCCAGGTGG - Intronic
1172632170 20:36385884-36385906 CCTCCCCACTTCAGCCCAGGAGG + Intronic
1172903157 20:38349537-38349559 CCTTTCCACAGCGGCCCAGGAGG + Exonic
1178280970 21:31282648-31282670 CCTTCCCACTGACGGCCCTGGGG + Intronic
1180009666 21:45040950-45040972 CCTGGCCACTGGTGCCCAGGTGG - Intergenic
1180135631 21:45860089-45860111 GTTACCCACTGAAGTCCAGGAGG - Intronic
1182887502 22:33787999-33788021 CCTGCCCAGTAAAGTCCAGGAGG + Intronic
1183593103 22:38793193-38793215 CCTAACCATGGAAGCCCAGGAGG + Intronic
1184034769 22:41913195-41913217 CCCTGCCTCTGAGGCCCAGGAGG + Intronic
1184249005 22:43249711-43249733 CTTTCCCACTGCAGCTCACGGGG - Intronic
949515495 3:4803487-4803509 CTTTCCACCTGAAGCCCAGTAGG - Intronic
949871198 3:8590682-8590704 CCTTCCCACTGAACCCTGGAAGG - Intergenic
950318400 3:12026136-12026158 TCTTCCCACTGTAGGCCATGAGG - Intronic
952852139 3:37738252-37738274 CCTCCCCACTGAAGCCCTTCTGG - Intronic
953183999 3:40621314-40621336 TCTTCCCACTGCTGCCCAAGTGG - Intergenic
954381562 3:50221638-50221660 CCATCCCACTGGATCCCAGCTGG - Intergenic
957470376 3:80651550-80651572 CCTTAGCCCTAAAGCCCAGGAGG - Intergenic
958949538 3:100401344-100401366 CTTGCCTACTGAAGCCGAGGAGG + Exonic
959346769 3:105204770-105204792 CCTACCTACTGTAGACCAGGAGG + Intergenic
961917187 3:130389224-130389246 ACTTAACACTGAAGTCCAGGTGG - Intronic
962198139 3:133380548-133380570 CCTTCGCAGAGCAGCCCAGGGGG + Exonic
963188022 3:142440102-142440124 CTTTACCACTGAGGGCCAGGAGG + Intronic
967587744 3:191235346-191235368 CCTTCCCACTGAAGCCTTCCAGG - Intronic
968054852 3:195683621-195683643 CATTTCCACTTCAGCCCAGGAGG - Intergenic
968101059 3:195965651-195965673 CATTTCCACTTCAGCCCAGGAGG + Intergenic
968621640 4:1605875-1605897 CCTCCCCACTGGAGTTCAGGGGG + Intergenic
968657157 4:1783584-1783606 CCACCCCACTGAAGAGCAGGGGG - Intergenic
969035279 4:4248433-4248455 CCGACCTACGGAAGCCCAGGAGG + Intergenic
969235396 4:5862014-5862036 GCTTCTCACAGGAGCCCAGGAGG - Intronic
970082338 4:12301800-12301822 CCTGTACACTGAAGCCCAAGTGG + Intergenic
970817637 4:20177001-20177023 CCTTCCCACTTCATCCCAAGTGG + Intergenic
972403856 4:38728799-38728821 CCTTGGCCCTGAAGGCCAGGAGG + Intergenic
973602039 4:52551858-52551880 ATTTTCCACTGAACCCCAGGTGG - Intergenic
973760430 4:54109869-54109891 CCAGCCCACTGAGGGCCAGGAGG - Intronic
973801903 4:54486827-54486849 TCTTCCCAGTGTAGCCCTGGTGG - Intergenic
975645719 4:76543812-76543834 CATTTCCTCTGAAGCCAAGGTGG + Intronic
977570837 4:98627644-98627666 TGTTCCCACTGAAATCCAGGGGG - Intronic
979342565 4:119543809-119543831 CCTTCCCAATGACCTCCAGGAGG + Intronic
981653718 4:147088428-147088450 CAATCCCACAGGAGCCCAGGAGG - Intergenic
982319603 4:154064476-154064498 CCTCCCTCCTGAAGCCTAGGAGG + Intergenic
985502025 5:254262-254284 CATTTCCACTTCAGCCCAGGAGG - Intronic
985561139 5:586670-586692 CCTTGCAGCAGAAGCCCAGGGGG - Intergenic
985734992 5:1574404-1574426 CATTTCCACTTCAGCCCAGGAGG + Intergenic
990485194 5:56251270-56251292 CCTTGGCACTTTAGCCCAGGTGG + Intergenic
995436221 5:112138979-112139001 CCTTACCACTGTTGCCCAAGGGG + Intergenic
995796848 5:115950317-115950339 TCTTCCCACAGAAGGCCAGGTGG - Intergenic
997706975 5:135964837-135964859 TCTTTCCACTGAAACACAGGAGG - Intergenic
997906598 5:137823223-137823245 CATGCACACTGAAACCCAGGAGG + Intergenic
1001401754 5:171450425-171450447 CGCTCCCAGTGAATCCCAGGAGG + Intronic
1001435848 5:171698741-171698763 CCTTCCCACAGAATCTCAGAGGG - Intergenic
1001515851 5:172354902-172354924 CCCTCCCACAGTAGCCCTGGAGG + Intronic
1002568795 5:180128682-180128704 CCCTCCCTTTGGAGCCCAGGTGG - Intronic
1004253168 6:14039233-14039255 CCTTATCAATGCAGCCCAGGAGG - Intergenic
1004321041 6:14631696-14631718 CCTTCCCTCTGAAGCCCAGGGGG + Intergenic
1004460243 6:15828497-15828519 CCTGCCCTCTGTAGTCCAGGTGG - Intergenic
1005888048 6:30112261-30112283 GCTGCCCACTCAAGCCCAAGGGG + Intronic
1006353030 6:33535311-33535333 CCTTCCCACTGGAGCACGGAAGG - Intergenic
1007695829 6:43733879-43733901 CTTTCCCACTCCAGCCCAGCAGG - Intergenic
1011822273 6:91267702-91267724 TCTTCCCACTGATGCCAAGGCGG - Intergenic
1012230160 6:96751578-96751600 CCTTCCCACTGAGTCCAAGTTGG + Intergenic
1013714671 6:112944683-112944705 CCTTTGCACTCCAGCCCAGGTGG + Intergenic
1015878433 6:137846996-137847018 CCTCCCCACTCCAGCCCAGTGGG + Intergenic
1016299440 6:142614045-142614067 CCCTCCAACTCAAGCCCATGGGG - Intergenic
1016519718 6:144933322-144933344 CCTTCCAACTGCAGACCAGTGGG + Intergenic
1017418521 6:154247459-154247481 CCTTGCGTCAGAAGCCCAGGAGG - Exonic
1017868616 6:158467140-158467162 CCTGTCCACTGAATCCCAGTGGG + Intronic
1018077058 6:160226827-160226849 CCTTCCCATTCAAGCCCTGATGG + Intronic
1018504003 6:164444069-164444091 ATTTCCCACTGGAGCCCTGGGGG + Intergenic
1019578604 7:1749360-1749382 CCTTACAGCAGAAGCCCAGGGGG + Intergenic
1021215961 7:17915369-17915391 CCTCCCCAGTGCCGCCCAGGGGG - Intronic
1021361522 7:19718824-19718846 TCTACCCACTAAATCCCAGGAGG - Intergenic
1022099034 7:27158196-27158218 CCTTCCTACCCAAGCCCCGGTGG - Intergenic
1022264566 7:28741429-28741451 CTTTCTCCCTGAAGTCCAGGTGG - Intronic
1022522108 7:31015095-31015117 GCTTCTCACTGAGGCCCAGGTGG - Intergenic
1022587842 7:31632728-31632750 CCCTACTACTGAAGCCCAGCTGG + Intronic
1022979325 7:35589330-35589352 CCATCCCACTTAAGCACAAGGGG - Intergenic
1030343620 7:108408853-108408875 TCATCCCACTGAACCCAAGGAGG - Intronic
1033922557 7:146412181-146412203 CCTTCCCCCTGGAGCCCTGCAGG + Intronic
1035204595 7:157287032-157287054 CCTCCCTACTGGAGCCCAAGAGG + Intergenic
1035735157 8:1882222-1882244 GCTTCCCACTGCACCCCATGTGG - Intronic
1036643564 8:10598829-10598851 CCTTCCCACTGCATCCCAGAAGG - Intergenic
1037187030 8:16076859-16076881 CATTCACACTGGATCCCAGGTGG - Intergenic
1037704918 8:21310607-21310629 CTTTCCCACTGACTCCCAGCTGG - Intergenic
1037705234 8:21311906-21311928 CTTTCCCACTGACTCCCAGCCGG - Intergenic
1037705624 8:21313455-21313477 CTTTCCCACTGACTCCCAGCCGG - Intergenic
1037705653 8:21313583-21313605 CTTTCCCACTGACTCCCAGCTGG - Intergenic
1037705818 8:21314298-21314320 CTTTCCCACTGACTCCCAGCTGG - Intergenic
1037911751 8:22747828-22747850 CCTTCCCACAGAGGCCCCGGGGG + Intronic
1038013491 8:23493859-23493881 CCTTCCCACTGACACCCAGTGGG - Intergenic
1040314134 8:46252018-46252040 CCTGCCCAGGGGAGCCCAGGGGG - Intergenic
1040372827 8:46794347-46794369 CATTCTCATTGAAGCCCAGGTGG - Intergenic
1040380274 8:46865347-46865369 CATGCTCACTGAAGCCCAGGTGG + Intergenic
1041392491 8:57359484-57359506 CCTTCCCATTGTAGACCTGGAGG + Intergenic
1047348397 8:124050325-124050347 CCTTCCCACTAAGACCAAGGGGG + Intronic
1047489483 8:125362823-125362845 CCATCCCACTGAAGTGAAGGTGG + Intronic
1051626160 9:19101932-19101954 CATTCCCACTGTAGGCCAAGAGG - Intronic
1055578186 9:77680701-77680723 CCTTCCCACTCAAGCCCCCATGG + Intergenic
1056755783 9:89381277-89381299 GCTTCCCACAGAAGGCCAGCGGG + Exonic
1057211279 9:93202408-93202430 CATTCCCACGGAAGCGCCGGAGG - Intronic
1058989180 9:110238720-110238742 CCTTTCCACTGTAACCCAGTGGG + Intergenic
1059404524 9:114091850-114091872 CCTCCCCATTGAAGGCCAAGTGG - Exonic
1059662508 9:116415920-116415942 CATACCCAGTGAAGCCAAGGTGG + Intergenic
1060090078 9:120735038-120735060 GATTCTCACTGAAGCCCAGCAGG - Intergenic
1061416058 9:130447516-130447538 CCATCCCAATGAAAGCCAGGTGG + Intronic
1061876160 9:133545198-133545220 CCTGCCCACTGTGGCCCAAGGGG - Intronic
1062113443 9:134795282-134795304 GCTTCCCAGTGATGCCCCGGGGG - Exonic
1062115436 9:134805819-134805841 CCTTCCCTCTAGAGCCCACGGGG - Intronic
1187482007 X:19665835-19665857 CCATCCCACTGAAAGCCAGTTGG + Intronic
1189282708 X:39830195-39830217 CCTTCCCACTGAACCCATGCTGG + Intergenic
1189436336 X:40996247-40996269 GCTTGACCCTGAAGCCCAGGAGG - Intergenic
1192509150 X:71711914-71711936 CCTCTCCACTGGGGCCCAGGTGG + Intergenic
1192517547 X:71769639-71769661 CCTCTCCACTGGGGCCCAGGTGG - Intergenic
1192554311 X:72077857-72077879 CCTTCCCTCTAAGGCGCAGGAGG - Intergenic
1195351052 X:103997317-103997339 CCATCCCTCTGAAACCGAGGAGG - Intergenic
1195352644 X:104009467-104009489 CCATCCCTCTGAAACCGAGGAGG - Intergenic
1195356450 X:104044095-104044117 CCATCCCTCTGAAACCGAGGAGG + Intergenic
1196116634 X:112006023-112006045 GCTTCCCTCTGAAACCCAGTTGG + Intronic
1197004497 X:121480356-121480378 CCCTCCCACCAAAGCCCTGGAGG + Intergenic
1197989395 X:132300929-132300951 CCTTCCCACCATAGCTCAGGTGG + Intergenic
1198788089 X:140313344-140313366 CCTTGCCACTGAGGGCCAAGGGG + Intergenic
1200042385 X:153379656-153379678 CCTTCCCACTGTGGCACATGGGG + Intergenic
1200124941 X:153808789-153808811 TCATCCCACTGAAGGCCAGCTGG + Intronic