ID: 1150714909

View in Genome Browser
Species Human (GRCh38)
Location 17:67563874-67563896
Sequence GAGAGAGAGAAATGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3415
Summary {0: 1, 1: 3, 2: 31, 3: 377, 4: 3003}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150714904_1150714909 -1 Left 1150714904 17:67563852-67563874 CCAATGGTGGGGGAGATGTGGGG 0: 1
1: 0
2: 6
3: 26
4: 274
Right 1150714909 17:67563874-67563896 GAGAGAGAGAAATGGGTGGATGG 0: 1
1: 3
2: 31
3: 377
4: 3003
1150714897_1150714909 13 Left 1150714897 17:67563838-67563860 CCAGAGAGACAGAACCAATGGTG 0: 1
1: 5
2: 41
3: 251
4: 1219
Right 1150714909 17:67563874-67563896 GAGAGAGAGAAATGGGTGGATGG 0: 1
1: 3
2: 31
3: 377
4: 3003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150714909 Original CRISPR GAGAGAGAGAAATGGGTGGA TGG Intronic
Too many off-targets to display for this crispr