ID: 1150723028

View in Genome Browser
Species Human (GRCh38)
Location 17:67629424-67629446
Sequence CAACATGCCCAGTAGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150723016_1150723028 19 Left 1150723016 17:67629382-67629404 CCTGCCTCAGGCTCCCAAGTAGC 0: 651
1: 79770
2: 181773
3: 219919
4: 222644
Right 1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG 0: 1
1: 0
2: 1
3: 7
4: 86
1150723018_1150723028 15 Left 1150723018 17:67629386-67629408 CCTCAGGCTCCCAAGTAGCTGGG 0: 821
1: 95512
2: 207388
3: 248015
4: 259548
Right 1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG 0: 1
1: 0
2: 1
3: 7
4: 86
1150723022_1150723028 5 Left 1150723022 17:67629396-67629418 CCAAGTAGCTGGGATTACAGGCA 0: 52453
1: 101789
2: 153905
3: 227834
4: 315316
Right 1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG 0: 1
1: 0
2: 1
3: 7
4: 86
1150723021_1150723028 6 Left 1150723021 17:67629395-67629417 CCCAAGTAGCTGGGATTACAGGC 0: 35616
1: 158937
2: 257753
3: 440394
4: 391946
Right 1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG 0: 1
1: 0
2: 1
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150723028 Original CRISPR CAACATGCCCAGTAGGGACG GGG Intronic
903481846 1:23659359-23659381 CACCATGCCCAGCCTGGACGTGG - Intergenic
907086819 1:51683161-51683183 CACCATGCCCAGTTGAGACCAGG + Intronic
910851941 1:91657212-91657234 CAACACTCCCAGCAGGGAGGGGG + Intergenic
910921083 1:92348061-92348083 CACCATGCCCAGTAGAGCTGGGG + Intronic
916238407 1:162613791-162613813 AAACATGCCCAGCCGGGACAAGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922208208 1:223467305-223467327 CCACATGGGAAGTAGGGACGGGG - Intergenic
1064040337 10:11957106-11957128 CACCATGCCCAGTATGGAGTAGG + Intronic
1070179378 10:73998988-73999010 TAAAATGCCCAGGAGGGAGGAGG - Intronic
1072899236 10:99392816-99392838 CTACATGCCCAGGAGAGATGGGG - Exonic
1073794619 10:106974291-106974313 CAAAATGCCTAGTAGGGAGACGG + Intronic
1076819127 10:132930044-132930066 CAGGGTGTCCAGTAGGGACGTGG - Intronic
1078375091 11:10786582-10786604 CAACATGCCCTGGAGAGACAAGG - Intergenic
1082801026 11:57414939-57414961 CAACATGGCCGGTGGGGACATGG - Exonic
1084371445 11:68747476-68747498 CACCATGCCTAGTAGAGACAGGG - Intronic
1084376999 11:68784386-68784408 CACCATGCCTAGTAGAGACAGGG - Intronic
1086373156 11:86174761-86174783 CAACATGCCCAGGAGGGTGAGGG + Intergenic
1086537589 11:87866786-87866808 CGACATGCCCAGAATGGAAGAGG + Intergenic
1089578957 11:119469537-119469559 CCACATGCCCAGGAGGGCCGGGG - Intergenic
1090918184 11:131185561-131185583 CCACATGGCCAGCAGGGAGGCGG - Intergenic
1091870894 12:3890403-3890425 GAACATGGGCATTAGGGACGTGG + Intergenic
1092053342 12:5489140-5489162 CATCAGGCCCAGGAGGGACTAGG + Intronic
1095765856 12:45895071-45895093 GAACAAGCTCAGTAGGGAAGGGG - Intronic
1103469040 12:121165318-121165340 CAAAATGGCCATTAGTGACGGGG - Intronic
1105821597 13:24085598-24085620 CAACATGCAGAGAAGGCACGTGG - Intronic
1107438745 13:40404843-40404865 CAACATGGCCAGTAAGGAGGCGG - Intergenic
1116888285 14:50241662-50241684 CAACATCCTTAGTAGAGACGGGG - Intronic
1118785631 14:69043457-69043479 CACAATGCCCAGTAGGAACTGGG - Intergenic
1119770294 14:77216496-77216518 GAACATGCTAAGTGGGGACGGGG - Intronic
1123501871 15:20893665-20893687 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123559124 15:21467364-21467386 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1123595355 15:21904645-21904667 CAGCATGCCCAGGAGGCAGGTGG + Intergenic
1127542253 15:59952373-59952395 CACTATGCCTAGTAGAGACGGGG - Intergenic
1130273486 15:82464486-82464508 CAACATCTGCAGTAGGGATGAGG + Intergenic
1130465837 15:84191857-84191879 CAACATCTGCAGTAGGGATGAGG + Intergenic
1130498428 15:84481679-84481701 CAACATCTGCAGTAGGGATGAGG - Intergenic
1130588126 15:85196453-85196475 CAACATCTGCAGTAGGGATGAGG + Intergenic
1132614461 16:833286-833308 CAGCATGGCCAGGAGGGGCGAGG + Intergenic
1135564245 16:23499634-23499656 GAAGATCCCGAGTAGGGACGGGG + Intronic
1138439632 16:57026304-57026326 CCCCAGGTCCAGTAGGGACGAGG - Exonic
1138704554 16:58901513-58901535 CAAAATGCCCAGTGTGGACCAGG - Intergenic
1138723994 16:59116156-59116178 CAACATTCCCATTAGGGACTCGG - Intergenic
1141608943 16:85170496-85170518 CAACATCACCAGTGGGGAAGAGG + Intergenic
1150299461 17:64036361-64036383 CATCAGGCCCAGTACGGACATGG + Intergenic
1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG + Intronic
1151659600 17:75511907-75511929 CAACCTGCCCAGTGGGGCCTTGG - Intronic
1153149675 18:2077413-2077435 CACCATGCCCGGTAGAGATGGGG - Intergenic
1160931773 19:1574142-1574164 CACCACCCCCAGTAGAGACGGGG - Intronic
1161765466 19:6205475-6205497 CAACATACCCTGTTGGGAGGTGG - Intergenic
1164402016 19:27909429-27909451 CACCAGGCACGGTAGGGACGGGG - Intergenic
1164544691 19:29150535-29150557 TACCATGCCCAGTAGAGACAGGG + Intergenic
1165184841 19:34009059-34009081 CATCATGCCTAGTAGAGACATGG + Intergenic
926721375 2:15963981-15964003 CAACATGCCCAGTGGACAGGAGG - Intergenic
928445590 2:31331145-31331167 CAACCTGCCCAAGAGGGAAGAGG + Intergenic
930923202 2:56782683-56782705 CAACATGCCCAGCAGGAAAGGGG + Intergenic
932546324 2:72714385-72714407 CAACAGGCCCAGTAGGGATGTGG - Intronic
945553077 2:211245675-211245697 CAACCTAACCAGTAGGGACTTGG - Intergenic
946015657 2:216602211-216602233 CAAAATCCCCACTAGGGAGGTGG + Intergenic
1170529807 20:17279631-17279653 CACTATGCCCAGTAGAGACAGGG - Intronic
1178406907 21:32331951-32331973 CAGCATGCCCAGCAGTGACTGGG + Intronic
1178582101 21:33846054-33846076 CCACATGTCCAATAGGGAGGTGG + Intronic
1178747280 21:35265189-35265211 CACCGTGCCCAGTTGGGATGAGG + Intronic
1182489205 22:30658968-30658990 CACCATGCCTAGTAGAGATGCGG - Intronic
1183393994 22:37561156-37561178 CAACATTCCCTGGGGGGACGGGG - Intronic
1183601960 22:38844840-38844862 CCACATGCCCACCAGGCACGTGG - Intergenic
1184026235 22:41858967-41858989 CACCACGCCCAGTAGAGACGGGG - Intronic
1184842326 22:47059235-47059257 CAAGATGCCCAGTAGGACCCTGG - Intronic
1185373908 22:50473421-50473443 CAACCTGCACAGTGGGGATGAGG + Intronic
949906517 3:8863038-8863060 CAACATGGACAGAATGGACGCGG + Intronic
953407278 3:42665681-42665703 GCACAGGCCCAGGAGGGACGAGG - Exonic
975148188 4:70993329-70993351 CAACAGGCCCACTAGAGAGGCGG + Intronic
981374940 4:144004025-144004047 TAACATGCCCAGATGGGACTTGG - Intronic
985685851 5:1281074-1281096 CAACAGTCCCAGTAGTGACAAGG + Intronic
997428597 5:133821795-133821817 CAACATGCTCAGAAAGGACAAGG + Intergenic
1001773068 5:174310165-174310187 CACCATGCCCAGCAGGCATGGGG + Intergenic
1001851524 5:174971080-174971102 CACCATGCCCCGTAGAGACGGGG - Intergenic
1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG + Intronic
1010551771 6:77232111-77232133 CAACCAGCCCAGTAGGAATGAGG + Intergenic
1015888365 6:137944221-137944243 TAACATTCCCAGTAGGGTCAGGG + Intergenic
1017349678 6:153425722-153425744 CTACATGCCCAGGAGGAAGGAGG - Intergenic
1017995684 6:159529901-159529923 CACCGTGCCCAGTAGTGACTGGG + Intergenic
1020967371 7:14888387-14888409 TAAGATGCCCAGTAAGGAAGAGG - Intronic
1022878810 7:34564691-34564713 CAGTATGTCCAGTAGGGACTGGG + Intergenic
1026562050 7:71458442-71458464 CAACATGCCCAATAGGGCTTTGG - Intronic
1034674380 7:152882057-152882079 CACCATGCCCAGCAGCGACTTGG - Intergenic
1038342288 8:26696716-26696738 CAGCAGGCCCAGTAGGTACAAGG - Intergenic
1038543844 8:28411040-28411062 CACTATGCCTAGTAGAGACGGGG - Intronic
1042042395 8:64606454-64606476 CAACAAGTCCAGTAGGGGTGTGG + Intronic
1048285421 8:133137539-133137561 CAGCATGTCCAGGAGGGGCGGGG + Intergenic
1056462698 9:86823688-86823710 CAACATGTCCAGTAGAGAGTGGG + Intergenic
1058361843 9:104157005-104157027 CACCATGCCCAGTAGAGATGGGG + Intergenic
1058771998 9:108244043-108244065 CAACTTGCCCAGTGGGGAATGGG + Intergenic
1187310373 X:18135819-18135841 GAACTTTCCCAGTAGGAACGAGG - Intergenic
1190945521 X:55089409-55089431 CAAACTCCTCAGTAGGGACGCGG + Intronic
1199735883 X:150686263-150686285 TAACATGTCCAGGAGTGACGGGG - Intergenic