ID: 1150723966

View in Genome Browser
Species Human (GRCh38)
Location 17:67636635-67636657
Sequence TACGAGGGAGTCGCCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150723966_1150723975 3 Left 1150723966 17:67636635-67636657 CCCCCAGGGGCGACTCCCTCGTA 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1150723975 17:67636661-67636683 CCAGCCCCATCACCTTCAACAGG 0: 1
1: 0
2: 1
3: 28
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150723966 Original CRISPR TACGAGGGAGTCGCCCCTGG GGG (reversed) Intronic
918544291 1:185664967-185664989 CACAAGGGAGTAGCGCCTGGCGG - Intergenic
1063476391 10:6332423-6332445 GGGGAGGGAGTTGCCCCTGGTGG - Intergenic
1067576215 10:47410111-47410133 GAGCAGGGAGTGGCCCCTGGAGG - Intergenic
1068247774 10:54394781-54394803 TAAGAGGCAGGCGCACCTGGGGG + Intronic
1070916717 10:80159795-80159817 TACATGGGAGTGGGCCCTGGAGG - Intronic
1074494701 10:113969522-113969544 TAAGAGGCAGGCGCACCTGGGGG + Intergenic
1076855040 10:133111716-133111738 TAGGAGGGAGGTGCCCGTGGCGG - Intronic
1076855078 10:133111842-133111864 TAGGAGGGAGGTGCCCGTGGTGG - Intronic
1092077569 12:5686108-5686130 TACCCGGGACTTGCCCCTGGGGG - Intronic
1104419935 12:128626962-128626984 TACTAGGGAGAGGCCCTTGGTGG - Intronic
1104857412 12:131908579-131908601 TGCGCGGGACTCACCCCTGGGGG + Intronic
1118817656 14:69324398-69324420 TACTAGGGAGCCCCCTCTGGGGG + Intronic
1119088473 14:71758808-71758830 TAGGAGGCATTCGCTCCTGGAGG + Intergenic
1124124282 15:26924481-26924503 CAAGAGGGAGTTGCCCCTGCTGG + Intronic
1132722776 16:1325097-1325119 AGCGAGGAACTCGCCCCTGGGGG - Exonic
1139340120 16:66262973-66262995 GAGGAGGGATTCTCCCCTGGAGG - Intergenic
1141459845 16:84171645-84171667 TCTGAGCGAGTCGCCCCTGCTGG + Intronic
1142854217 17:2721093-2721115 TAGGATGGCGTCCCCCCTGGTGG - Intergenic
1146669809 17:34729116-34729138 AGCAAGGGAGGCGCCCCTGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147948277 17:44092735-44092757 TAGGAGGGAGGCGTCCCAGGGGG + Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150723966 17:67636635-67636657 TACGAGGGAGTCGCCCCTGGGGG - Intronic
1151960035 17:77400925-77400947 TCCGAGGGAGCAGACCCTGGTGG + Intronic
1161473603 19:4473035-4473057 CCCGAGGGAGTCGCACCTTGGGG + Intronic
1168382032 19:55932149-55932171 TACGCGGGAAGTGCCCCTGGGGG + Exonic
926812756 2:16771039-16771061 CTCCAGGGAGTCTCCCCTGGGGG + Intergenic
948649518 2:239431810-239431832 CACGTGGGATTCGACCCTGGTGG + Intergenic
1179428790 21:41304393-41304415 CCCGAGGGAGTCGCCCCCGAAGG + Intronic
1183685812 22:39360865-39360887 GACGAGGCTGTCGCCCCTGCTGG + Intronic
1184426344 22:44411251-44411273 TCCTATGGAGTAGCCCCTGGGGG - Intergenic
1185182010 22:49369080-49369102 GACGAGGGCGTGGCTCCTGGAGG - Intergenic
958619504 3:96538427-96538449 CAGGAGGGAGTGGCCCCTGGAGG - Intergenic
969289269 4:6228212-6228234 TAGGAGGGAACGGCCCCTGGCGG - Intergenic
985844038 5:2330900-2330922 TACGAGGGAGCCGTGGCTGGCGG - Intergenic
991053539 5:62298091-62298113 TGAAAGGGAGTCGACCCTGGAGG - Intergenic
994065958 5:95542659-95542681 TACGATGTAGTAGGCCCTGGAGG - Intronic
995036873 5:107544100-107544122 TACTTGCGAATCGCCCCTGGTGG + Intronic
998395041 5:141812752-141812774 TAGGAGAGAGACGCCCCAGGAGG + Intergenic
1001959594 5:175872158-175872180 GAGGAGGGAGTCGCCCCCAGGGG + Intronic
1010141945 6:72622344-72622366 TAGCAGGCCGTCGCCCCTGGCGG - Exonic
1011643185 6:89433574-89433596 GAAGAGGGAGGCGCCCCGGGGGG - Intronic
1021252787 7:18352487-18352509 TGCCAGGGAGTCACCTCTGGAGG + Intronic
1029746509 7:102518037-102518059 CTCGAGGGGGGCGCCCCTGGAGG + Intergenic
1029764446 7:102617016-102617038 CTCGAGGGGGGCGCCCCTGGAGG + Intronic
1035242607 7:157542108-157542130 TACGTGGGAGCTGCCCCTGTGGG + Intronic
1037568306 8:20136310-20136332 CACGAGGAAGTCTCCACTGGAGG + Intergenic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1056626840 9:88260729-88260751 GACGAGGGAATGGCCCCAGGTGG + Intergenic
1057060958 9:92003728-92003750 TACGAGGGAGGCGGGCCTGGGGG - Intergenic
1057099146 9:92341063-92341085 TAAGAGACAGGCGCCCCTGGGGG - Intronic
1197818686 X:130524316-130524338 TCCGAGGGTGACGCCCCTTGAGG - Intergenic