ID: 1150724027

View in Genome Browser
Species Human (GRCh38)
Location 17:67636969-67636991
Sequence TGCCCAGGAAAACTCAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 327}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150724027_1150724039 24 Left 1150724027 17:67636969-67636991 CCCTTTCTGAGTTTTCCTGGGCA 0: 1
1: 0
2: 4
3: 31
4: 327
Right 1150724039 17:67637016-67637038 GGCAGCAAAGTTCTGGTCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 106
1150724027_1150724031 0 Left 1150724027 17:67636969-67636991 CCCTTTCTGAGTTTTCCTGGGCA 0: 1
1: 0
2: 4
3: 31
4: 327
Right 1150724031 17:67636992-67637014 TGCCCCCACCACTGCTGGTCTGG 0: 1
1: 0
2: 1
3: 31
4: 229
1150724027_1150724034 3 Left 1150724027 17:67636969-67636991 CCCTTTCTGAGTTTTCCTGGGCA 0: 1
1: 0
2: 4
3: 31
4: 327
Right 1150724034 17:67636995-67637017 CCCCACCACTGCTGGTCTGGAGG 0: 1
1: 1
2: 6
3: 22
4: 277
1150724027_1150724030 -5 Left 1150724027 17:67636969-67636991 CCCTTTCTGAGTTTTCCTGGGCA 0: 1
1: 0
2: 4
3: 31
4: 327
Right 1150724030 17:67636987-67637009 GGGCATGCCCCCACCACTGCTGG 0: 1
1: 0
2: 2
3: 23
4: 181
1150724027_1150724038 17 Left 1150724027 17:67636969-67636991 CCCTTTCTGAGTTTTCCTGGGCA 0: 1
1: 0
2: 4
3: 31
4: 327
Right 1150724038 17:67637009-67637031 GTCTGGAGGCAGCAAAGTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150724027 Original CRISPR TGCCCAGGAAAACTCAGAAA GGG (reversed) Intronic
900823565 1:4908757-4908779 TGCCCATGCAAATTCAGAACGGG + Intergenic
902221969 1:14972063-14972085 TTCCCAGGAAAGGTCAGAGATGG + Intronic
902395057 1:16128031-16128053 TTCCCAGGAAAAAGGAGAAAAGG + Intronic
902709383 1:18228117-18228139 TGCCCAGGACAACTCAGGACTGG - Intronic
904614670 1:31743298-31743320 GGCACAGGAAAATTCAGGAAAGG + Intronic
905620568 1:39442388-39442410 TACTCAGGAAAAGACAGAAAGGG - Intronic
905794682 1:40808958-40808980 GGCCCAGAAAAAGTGAGAAAGGG - Intronic
906123630 1:43412220-43412242 TGCCCAGAAATACTCACAATAGG + Intronic
906652935 1:47525959-47525981 AGCCCAAGAAAGCTCAGAATGGG - Intergenic
906796886 1:48703729-48703751 TGCTAAGGAAAATTCAGAGATGG - Intronic
906812233 1:48839708-48839730 AGCCCAGGAAAAATAAGAAATGG + Intronic
906850508 1:49244374-49244396 TGCCCAGAAAGACTGAGAGAAGG + Intronic
907176264 1:52525920-52525942 TTCACAGGCAAAATCAGAAAAGG - Exonic
908513104 1:64865228-64865250 TGTGCACGGAAACTCAGAAAGGG + Intronic
909379638 1:74983770-74983792 TTCCTAGTAAAACACAGAAAAGG - Intergenic
911704609 1:100997054-100997076 TTCCCAGGAAAGCTAAGAAAAGG + Intronic
912584448 1:110749761-110749783 ATCCCAGGAAAACTCAGATTGGG + Intergenic
912669996 1:111616689-111616711 TCCCCAGCAAAACTCAGACCTGG + Intronic
913048640 1:115095585-115095607 TGCCCAGGAAGAGTGTGAAAAGG + Intergenic
913354364 1:117902002-117902024 TCCCAAGGAAAACTCAATAAAGG + Intronic
913498989 1:119453293-119453315 TGCCAAGGGCAACTGAGAAAAGG + Intergenic
916061354 1:161100724-161100746 AGCCAAGGAAAACTCAGAAGGGG - Exonic
916935015 1:169618628-169618650 TGCCCTGGAAATGTCAGCAAGGG - Intronic
918341897 1:183574727-183574749 TTCCCAGGAGAGCTGAGAAAGGG - Intronic
920615843 1:207491952-207491974 TGTCCTGGAAAAGACAGAAAGGG - Intergenic
922539292 1:226407090-226407112 GGCTCAGGAAACCTCAGAAGGGG + Intronic
923041701 1:230324196-230324218 TGCAGAGGCAAACTCACAAATGG - Intronic
923355003 1:233145807-233145829 TGCCCAGGAGCAGTCAGCAAGGG - Intronic
923355748 1:233153752-233153774 TGTACAGGGAAAATCAGAAATGG + Intronic
923403011 1:233633635-233633657 TGTTTAGGAAAACTCTGAAAAGG + Intronic
924137504 1:240985435-240985457 TGCCCAGAAAAAAAAAGAAAAGG - Intronic
924171000 1:241340957-241340979 TGCCAGGGAAATCTCTGAAACGG + Intronic
1063106814 10:2999227-2999249 TGCCTGGGAAAACTCCAAAATGG + Intergenic
1064107574 10:12513039-12513061 TGCCCAGGCCAGCTCAGAAGAGG + Intronic
1065753479 10:28909876-28909898 TTCCCAGGAAAATTCAGAAGGGG - Intergenic
1065759107 10:28965186-28965208 TGCCCTGGAAGTCTAAGAAAAGG + Intergenic
1067200282 10:44164462-44164484 TGCTCAGGAAAGACCAGAAAGGG - Intergenic
1068166408 10:53337773-53337795 AGCCCAGAAAAAGTAAGAAAAGG + Intergenic
1068337864 10:55660841-55660863 AGCACAGGAAGACTGAGAAAAGG + Intergenic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069821640 10:71232163-71232185 TGCCCAGGAACTCCCAGGAATGG + Intronic
1069970425 10:72163273-72163295 TGCCCAAGAGAACTGAAAAAGGG + Intronic
1070354359 10:75625407-75625429 TGCATAGGAAAAGACAGAAACGG - Intronic
1070877696 10:79828433-79828455 TTACCAGGAAAACTGAGAAGGGG - Intergenic
1071084180 10:81848996-81849018 TGGCTAAGAAAACTGAGAAAAGG + Intergenic
1071477760 10:86039375-86039397 GGGCTAGAAAAACTCAGAAAGGG - Intronic
1071644198 10:87344477-87344499 TTACCAGGAAAACTGAGAAGGGG - Intergenic
1071855032 10:89615465-89615487 TGCCAAGAAAAACTTTGAAATGG - Intronic
1072154118 10:92708366-92708388 TGCATAGGAAAACCCAGATATGG - Intergenic
1074348621 10:112713051-112713073 TGGCCATGGAAACACAGAAAGGG - Intronic
1075013373 10:118893357-118893379 CCCCCAGGAAAACTCAAGAAGGG + Intergenic
1075237670 10:120745754-120745776 TCCCCAGGAAAACTGAGGAGAGG - Intergenic
1075591905 10:123697952-123697974 TGCCCAGGATCACACAGTAAGGG + Intergenic
1075898256 10:126017007-126017029 TGCCATGGAAAACTCAGTGATGG + Exonic
1076775355 10:132693210-132693232 TGCCCAGTAAAAGCCAGAGAAGG + Intronic
1078301815 11:10138920-10138942 TTCCAAGGAAAACGCAGACAAGG - Intronic
1079239903 11:18714863-18714885 TGACCAGGAAAACTGGGAGATGG + Intronic
1079317285 11:19419484-19419506 TGCCAAGCAAAGCGCAGAAAGGG - Intronic
1080870881 11:36236081-36236103 TGTCCAGGAAGAACCAGAAATGG + Intergenic
1081334266 11:41844332-41844354 TGCCCAGCAAAATTCAGCTATGG + Intergenic
1081493997 11:43588064-43588086 TGCTCAGAAAGACTCAGAACTGG - Intronic
1081524236 11:43913926-43913948 TTCCCTGGAAAACCCAGAAGAGG + Intronic
1081742979 11:45453916-45453938 TGCCCAGTAAAGCTCAAACAAGG + Intergenic
1089246828 11:117127569-117127591 CACACAGGAAAAGTCAGAAACGG + Intergenic
1089846581 11:121463441-121463463 TGCCAAGGATCAATCAGAAAGGG + Intronic
1090365186 11:126199631-126199653 GGCCTAAGAAAACACAGAAAAGG + Intergenic
1090578275 11:128132473-128132495 TGCCCAGGTGAAATCAGGAAGGG - Intergenic
1090775449 11:129961080-129961102 TGCCTGAGAAAACACAGAAAAGG + Exonic
1091859549 12:3767955-3767977 TGCTCAATAAAACTCAGAGAAGG + Intergenic
1091972145 12:4796580-4796602 TGCCCAGAGACCCTCAGAAATGG + Intronic
1093844189 12:23948923-23948945 TGGCCACTAAAACTTAGAAAGGG + Intronic
1093882126 12:24416803-24416825 TGCCCAAGATCACTCAGATAGGG - Intergenic
1094543948 12:31386498-31386520 TGCCCTGAAACACCCAGAAAGGG + Exonic
1095121790 12:38427586-38427608 TGCCCAGCAGAACTCAAAACAGG - Intergenic
1095299401 12:40565135-40565157 GGCACAGAAAAACTGAGAAAGGG + Intronic
1097349036 12:58527428-58527450 TGCCCAGGGAAACTCTGGTAAGG - Intergenic
1097903564 12:64897459-64897481 TGCAAAGGAAAACAAAGAAATGG + Intergenic
1098450657 12:70614763-70614785 TTCGAAGTAAAACTCAGAAAAGG - Intronic
1099104465 12:78481960-78481982 AGACAAGGAAAACTCGGAAAAGG + Intergenic
1100867866 12:98876305-98876327 TCACCAGGAAACCTGAGAAAGGG - Intronic
1101073332 12:101099571-101099593 TGCCCAGGTTAATTCAGAATTGG + Exonic
1101688915 12:107056265-107056287 TGCCAAGGCAACCTCACAAAAGG - Intronic
1102941190 12:116943665-116943687 TGCCCAGGAAAGACCAGAGAAGG - Intronic
1103781871 12:123404112-123404134 TGCCCAGGGAAACTTTTAAAAGG + Intronic
1104567888 12:129901962-129901984 TGCACAGGAAACCAAAGAAAAGG - Intronic
1105439646 13:20404656-20404678 GGCCCTGGAAAACTCTGGAATGG + Exonic
1105935439 13:25094314-25094336 TGCCCATGAACACACCGAAATGG + Intergenic
1106940650 13:34775222-34775244 TGCTCAGGAAAACAATGAAATGG + Intergenic
1108463901 13:50695266-50695288 AGCCCAGGAAAATACACAAATGG + Intronic
1109505691 13:63299890-63299912 AGCCCAGGCAAACTAAGACAAGG + Intergenic
1110777562 13:79426574-79426596 TAGCCAGGAAAGCTCTGAAAAGG - Intergenic
1111140160 13:84106682-84106704 TGCACTTGAAAGCTCAGAAAGGG + Intergenic
1112231317 13:97591542-97591564 TGACCAGGATAACTGAGGAAAGG - Intergenic
1112632791 13:101180559-101180581 AACTCAGGGAAACTCAGAAAGGG + Intronic
1113060986 13:106322751-106322773 TGCCTGGGAAATCTCTGAAATGG - Intergenic
1113284145 13:108828301-108828323 TCACCAGGAACACTCAGAGAGGG - Intronic
1114833229 14:26171004-26171026 TGAGCAAGAAAACTTAGAAAGGG + Intergenic
1115425572 14:33255035-33255057 TGGCCAGGAAAACTTGGAATTGG + Intronic
1116176701 14:41479775-41479797 TCCCCAGGACAACTCAAAGAGGG - Intergenic
1117098778 14:52324177-52324199 TGTTCAGGAAAACACAGACATGG + Intronic
1117280033 14:54230709-54230731 TGCACAAGAGAACACAGAAAAGG + Intergenic
1118931956 14:70251034-70251056 TGCCCAGGAGAATAAAGAAAAGG - Intergenic
1119460023 14:74793920-74793942 TGCCCAGAGAACCTCAGAGAAGG - Intronic
1119552117 14:75522591-75522613 GGCCCAGGAGAAGTCAGGAAGGG + Exonic
1121503739 14:94460679-94460701 TGCCCATGAAAACACAGAGAGGG - Intergenic
1124403108 15:29367626-29367648 TGCCCAGGAAAGCCCTGAGAAGG + Intronic
1124716294 15:32065615-32065637 TGCTCAGGAAAAATCTGAGAAGG + Intronic
1124807123 15:32896165-32896187 TGAAAAGGAAATCTCAGAAATGG - Intronic
1125401216 15:39305246-39305268 AGCCCTGTAAAACTTAGAAATGG + Intergenic
1125726209 15:41869551-41869573 TGCCCAGGAAAGCTCATAACTGG - Intronic
1126107671 15:45157449-45157471 ACCCCAGGACAAATCAGAAAGGG - Intronic
1126860529 15:52878411-52878433 TGCAAAGGAAAGCTAAGAAAAGG - Intergenic
1127065392 15:55232015-55232037 TGCCCAGGAAAGATCTAAAAAGG + Intronic
1127322838 15:57864173-57864195 TTCCCTGGCAAACTCAGAACAGG + Intergenic
1127472208 15:59300400-59300422 TGCCAATAAAGACTCAGAAATGG - Intronic
1127574134 15:60273511-60273533 TGCCCTGGAAAATTCACACATGG + Intergenic
1127714754 15:61639206-61639228 TTCCAAGGGAAACTCAAAAAAGG - Intergenic
1128267717 15:66281145-66281167 TGCCCAGGAAGAGTCAGAAGAGG - Intergenic
1130022948 15:80246402-80246424 AACCCAGGAAAAATCACAAACGG - Intergenic
1130028091 15:80286888-80286910 AGCCCAAGCAAAATCAGAAAAGG + Intergenic
1131766120 15:95677589-95677611 TACCAAGGCAAACTCAGAGAAGG - Intergenic
1131999090 15:98162101-98162123 GGCCCAGGCAAACTCAGGAAAGG - Intergenic
1132275693 15:100561645-100561667 TAACCAGAAAAACTCAGAAATGG + Intronic
1135154280 16:20038944-20038966 TTGACAGGAAAGCTCAGAAATGG - Intronic
1136229687 16:28879075-28879097 TACCCAGGAAAAAGAAGAAAAGG - Intronic
1136284863 16:29234724-29234746 TGCCCAGAAAAACAGAGACAAGG - Intergenic
1137328736 16:47469056-47469078 TGAACAGGAAAACTAAGAAGGGG - Intronic
1138373903 16:56549272-56549294 TACCCAGTAAAGCTCAGAAGGGG - Intergenic
1138955822 16:61969360-61969382 TGCCAAGAAAGATTCAGAAAGGG - Intronic
1140690086 16:77474072-77474094 TGTCCAGGAAAACTAAAATAAGG + Intergenic
1140974979 16:80051055-80051077 TCCTCAGGAAAAATCTGAAAGGG + Intergenic
1141256800 16:82409816-82409838 TGTCCAGCAAGACTCAGTAAGGG - Intergenic
1143739206 17:8940430-8940452 GACCCAGGAAAACTCACGAAGGG + Intronic
1143985665 17:10911550-10911572 TTCCCAGGAAGAATGAGAAAAGG - Intergenic
1147641419 17:42003470-42003492 TGCCCTGGAAGTCTGAGAAAGGG + Intronic
1148130357 17:45258410-45258432 TGCCCAGGGAAATTCTGTAAAGG - Intronic
1148962899 17:51408271-51408293 TGCCCAGGAGGACAAAGAAATGG + Intergenic
1149306437 17:55351327-55351349 TGCCCAGGAAAGATCTGAGAAGG + Intergenic
1149357885 17:55862540-55862562 TGCCCTGGGGAACTCAGGAAGGG - Intergenic
1149552508 17:57550755-57550777 TTCCTAGGAAAACTCAGAGCAGG + Intronic
1149828260 17:59849169-59849191 TGACAAGGAAAGATCAGAAAAGG - Intergenic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151151036 17:72086977-72086999 GGCCCAGGAAAGCTCTGCAACGG + Intergenic
1151972425 17:77465707-77465729 AGCCCAGAACAAGTCAGAAAGGG + Intronic
1153507407 18:5815450-5815472 TGCTCAAGCAAACTGAGAAAAGG + Intergenic
1154144144 18:11852120-11852142 TGGCCAGGAAACCTCAGAGCGGG - Exonic
1154239824 18:12642664-12642686 TGCCCAGGACTATTTAGAAATGG + Intronic
1155103174 18:22634189-22634211 ACCCCAGCAACACTCAGAAAAGG - Intergenic
1155772176 18:29715437-29715459 TGCCCAGGAAATATCAGAGGTGG + Intergenic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1157927029 18:51777954-51777976 TGAAAAGGAAAACTCAGAGAGGG - Intergenic
1158038569 18:53065642-53065664 TGCTCAGGAAAAAAAAGAAAGGG - Intronic
1158076098 18:53531571-53531593 TGCCAAGGAGAACTCAGGGAGGG - Exonic
1158106629 18:53892000-53892022 TACACAGGAAAAATAAGAAAAGG + Intergenic
1158326473 18:56318800-56318822 TTCCCAGTAAAAATCAGAATAGG + Intergenic
1158418789 18:57274095-57274117 TCTACAGGAAAACTCAGAGATGG + Intergenic
1159783553 18:72688042-72688064 TGGCCAGTAAAACTCAAATAGGG - Intergenic
1161052271 19:2170795-2170817 TGCCCATGAATACTGAGAAATGG + Intronic
1161673225 19:5626013-5626035 AGCCCAGAAGAACTCAAAAAGGG - Intronic
1162292400 19:9789967-9789989 TGCCCAAGAAAGCTCTGAGATGG - Intronic
1162805694 19:13137043-13137065 TGCTCAGGAAAGGACAGAAAGGG - Intronic
1163075057 19:14882950-14882972 TCCCCACGAGAATTCAGAAATGG + Intergenic
1163123616 19:15232542-15232564 GGCCCAGGAAGACTCAGCAGCGG + Intronic
1163466714 19:17472044-17472066 TGAGCAGGAAAATTCAGCAAAGG - Intronic
1166323099 19:42031512-42031534 AGCCCAGGTTAACTCAGAAGGGG - Intronic
927157227 2:20227703-20227725 CGCCCAGGAGAAAACAGAAAAGG - Intergenic
927614466 2:24577932-24577954 TGCACAGGTAAACTCAGATAAGG - Intronic
927626196 2:24721585-24721607 TGCCCAGGGAATCTCCCAAAGGG - Intronic
927725710 2:25421111-25421133 TGCCTAGGAAGTCTCAGGAATGG + Intronic
929035644 2:37688874-37688896 GGCCCAAGAAACCACAGAAAAGG - Intronic
929792035 2:45030459-45030481 TTTCCAGGAAAACTCAGAGAAGG + Intergenic
929998594 2:46845929-46845951 TGCCCAGGCCAATTCAGAGAAGG - Intronic
930390759 2:50759287-50759309 TCCCATTGAAAACTCAGAAATGG + Intronic
930602404 2:53457420-53457442 TGCCCAGGAAGAAGCAGCAATGG + Intergenic
930865647 2:56119921-56119943 TGCCCAGGAAAACTAAGACCTGG - Intergenic
931645021 2:64414360-64414382 TGCTGAGAAAAACACAGAAAAGG + Intergenic
931883592 2:66592029-66592051 TGACCAGGAAAATTCACCAAAGG - Intergenic
932405021 2:71507006-71507028 TGCTCAGGAAACCCCAGAAGGGG + Intronic
933406560 2:81867183-81867205 TGCCCAGGAAAAATCTCTAATGG - Intergenic
933772194 2:85751689-85751711 TGCTCAGGAAACCTCTGATAAGG - Intronic
933877047 2:86630265-86630287 AACCCAGGAAAAGTCAGAAATGG - Intronic
933899339 2:86837843-86837865 TCCACAGAAAAACACAGAAAAGG + Intronic
934621529 2:95812384-95812406 TTCCTAGGAGGACTCAGAAAGGG - Intergenic
934733451 2:96673957-96673979 TGCCCAGAAAGGCTCAGAATGGG - Intergenic
935677512 2:105608795-105608817 TGCCCAGAATAAATCATAAAGGG - Intergenic
935781221 2:106511385-106511407 TCCACAGAAAAACACAGAAAAGG - Intergenic
936084543 2:109457767-109457789 TGCCCAGAAAAACTCAGTGATGG + Intronic
937475712 2:122213454-122213476 TTCTCAGGAAACCTCTGAAAAGG - Intergenic
937999941 2:127725190-127725212 TGCCCATAAAAACACAGTAATGG - Exonic
938760787 2:134424123-134424145 TGCAAAGTAAAACTCAGAAGTGG + Intronic
940281794 2:151996804-151996826 TGCCCAGGAAACTAAAGAAAAGG + Intronic
940990183 2:160088425-160088447 TGAACAGGAAAACTCAACAATGG - Intergenic
941856450 2:170235887-170235909 TGGCCAAGAAAACTGAGAACGGG + Intronic
944912087 2:204321054-204321076 AGCCCAAGAGAACACAGAAAAGG + Intergenic
946046455 2:216825246-216825268 TGCCCAGGAAAAAGAGGAAATGG + Intergenic
946337483 2:219048230-219048252 AGCACAAGAAAACTCTGAAATGG - Intergenic
947860053 2:233352370-233352392 TTCCCAGGAAAACGCAAAAACGG - Intergenic
948569048 2:238905783-238905805 TGCCCAGGACCACTTAAAAAAGG + Intronic
949001660 2:241618023-241618045 TGCCAAGGCACACACAGAAAGGG + Intronic
1169100025 20:2939503-2939525 TGACCAGGCAAACTAAAAAAGGG - Intronic
1169201578 20:3712786-3712808 TCCCCAGGCAAAGTGAGAAATGG + Intergenic
1171346136 20:24468308-24468330 TGGTCTGGAACACTCAGAAACGG - Intergenic
1172016541 20:31878563-31878585 TGTCCAGTAATAATCAGAAATGG + Intronic
1173068334 20:39736607-39736629 TGCCCAGGGAAAAAGAGAAAAGG - Intergenic
1173688872 20:44943312-44943334 GGCCCAGGATAACTCAGAGCAGG - Intronic
1174755644 20:53155685-53155707 GGCCCAGGAAAAATTACAAAAGG + Intronic
1175123383 20:56734109-56734131 GGCCCAGGTAAAATCAGATAAGG + Intergenic
1177010328 21:15724490-15724512 AGTTCATGAAAACTCAGAAAAGG - Intergenic
1177084556 21:16687276-16687298 TGCCTAGAATAACTCAAAAATGG + Intergenic
1177275005 21:18899176-18899198 TGCCCACTAAAACAAAGAAATGG - Intergenic
1179019738 21:37627726-37627748 TGCCCAAGAAAAACCAGAGAAGG + Intronic
1180556926 22:16585738-16585760 TGATCAGGAAAAATCATAAAAGG - Intergenic
1181309876 22:21938902-21938924 TGGCCAGGGGAACCCAGAAATGG - Intronic
1181396664 22:22627947-22627969 TCCCCTTGAAAACTCAGAACTGG - Intergenic
1181646442 22:24233762-24233784 GGCCCAAGAACACCCAGAAACGG + Intronic
1181704789 22:24643504-24643526 TCCCCTTGAAAACTCAGAACTGG - Intergenic
1181758301 22:25040686-25040708 TTCCCAGGTAAAATCAGAGATGG + Exonic
1183544566 22:38448705-38448727 TGCCCAGGGTCACTCAGCAATGG - Intronic
1184966934 22:47983542-47983564 TGCCCAGGAAAATTGACAACAGG - Intergenic
949302760 3:2603863-2603885 TGCCAGGGAAATTTCAGAAAGGG - Intronic
949917831 3:8978351-8978373 TGCCCATGAAAAATAATAAATGG - Intergenic
949917978 3:8979725-8979747 TGCCCATGAAAAATAATAAATGG - Intergenic
952008076 3:28865614-28865636 TGCCCAGCAAAAGAAAGAAAGGG - Intergenic
952782934 3:37121676-37121698 TTCCCAGGAAGATTCGGAAAGGG - Exonic
953508238 3:43507643-43507665 TGACCAGGGACACTCAGGAAAGG + Intronic
953564100 3:44016376-44016398 TGCCCACCTAAAATCAGAAAAGG + Intergenic
954586286 3:51739577-51739599 AGCCAAGGAAAACTCAAAAGGGG + Intergenic
954864371 3:53716744-53716766 TGCCCAGGAACACTGAGGCAAGG - Intronic
955087488 3:55717408-55717430 TGCCAAGGAATAATCAGAAAAGG + Intronic
957643665 3:82890535-82890557 TGCTCAGGAGAGCTGAGAAAAGG - Intergenic
960801333 3:121543681-121543703 TGCCCATGAAAACCCATATAGGG + Intronic
961698466 3:128723294-128723316 AACCAAGGAAAACTCAGACATGG + Intergenic
962748030 3:138412003-138412025 TCCCCAGCAAAACTCAGGAATGG - Intergenic
963283741 3:143412740-143412762 TGCACAGAAAATCTAAGAAAAGG - Intronic
963908510 3:150794385-150794407 TGCCCATGACAAGGCAGAAAAGG - Intergenic
964529049 3:157647368-157647390 TGCCCAAGACAGCTCAGAAATGG + Intronic
968133545 3:196207067-196207089 TACCCACGAACACTCAGAGAGGG - Intronic
969437334 4:7195568-7195590 TGCCTGAGAAAACTCAGAAGAGG + Intronic
971536466 4:27758146-27758168 TACCCAGGAATGCTCAGAAAAGG + Intergenic
972436253 4:39038035-39038057 TCCCCAAGAAAACCAAGAAATGG - Intergenic
972542481 4:40051445-40051467 TGCCTAGGAACTCTAAGAAAAGG - Intergenic
973565125 4:52178024-52178046 TGCCCAGGAAAGATCTGAGATGG + Intergenic
974423955 4:61716280-61716302 TACTCAGGAAAATTTAGAAAAGG - Intronic
975223979 4:71847833-71847855 TAACCAAGAAAACTCAGAAATGG - Intergenic
975827507 4:78335224-78335246 TGCCCAGCAATCCTCAGAACTGG - Intronic
975978481 4:80127060-80127082 TGCCCAAGAATACACAGGAAAGG - Intergenic
975986495 4:80205536-80205558 TGCCTAGGAAAACTGAGAGCAGG - Intergenic
977461710 4:97333888-97333910 TAGCCAGGAAAATTCAGCAAAGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
979202377 4:117993859-117993881 TCCCCAGGAAAAGACAGAAATGG - Intergenic
979235358 4:118393925-118393947 TGCATAGGAAAAGTAAGAAAAGG + Intergenic
981468706 4:145103688-145103710 TAGCCAGGAAAACTGAAAAAGGG - Intronic
981736976 4:147963354-147963376 TGGCCAGGGAAGCTCAGGAAGGG - Intronic
982506835 4:156228936-156228958 TGCTCATGAAAACTCAGCACTGG + Intergenic
983357351 4:166680683-166680705 TGATAAGGAAAAATCAGAAATGG - Intergenic
983925702 4:173399565-173399587 TGGCTAGGAAAACTGTGAAAGGG - Intronic
984759985 4:183355682-183355704 TGCCAAGGAAAAATAATAAATGG + Intergenic
986628197 5:9742723-9742745 TGGCCAGGAAAACTTAAAAAGGG + Intergenic
986982543 5:13465911-13465933 TGCTCAGGAAACCTCAGAAAAGG + Intergenic
987194297 5:15509956-15509978 TACCCAGGAAAATTCAGAGATGG - Intronic
987928056 5:24366872-24366894 AGCCCGAGAAAACTCAGAGAGGG - Intergenic
988723405 5:33901640-33901662 TGCACAGGAAACTGCAGAAAAGG + Intergenic
989373119 5:40730796-40730818 TGCTCAGAAAAACTTAGAAATGG + Intronic
989796185 5:45476443-45476465 AGCCCAAGAAAACTAAGACAAGG + Intronic
993493028 5:88574963-88574985 TGCCCATGAAAATTGAGTAATGG + Intergenic
993625979 5:90225072-90225094 AGCACAGGAAAACTCAGCCATGG + Intergenic
993927526 5:93888100-93888122 AACCCAGGAAAAGTTAGAAATGG - Intronic
994355312 5:98787835-98787857 GGCCCAGGAAGACACATAAAAGG - Intronic
995653170 5:114394925-114394947 TAGCCAGGAAAATTCTGAAAAGG - Intronic
997648364 5:135496798-135496820 TGCCCAGGAAGATTCCTAAATGG - Intergenic
998975740 5:147644849-147644871 TACCAAGGAAAATTCAGAAATGG - Exonic
999422849 5:151459714-151459736 TCCACAAGAAAACACAGAAAAGG - Intronic
999550648 5:152683636-152683658 TGGCCTGGAAAACTCACAACAGG - Intergenic
1000109116 5:158090221-158090243 TGTCCAAAAAAACTCAGAAGGGG + Intergenic
1000865250 5:166505781-166505803 TGCCCATGGAAACTCACAAGTGG - Intergenic
1001544982 5:172565458-172565480 TGCCAGGGAACATTCAGAAATGG + Intergenic
1002005887 5:176234547-176234569 TGCCCAGAAAAACTGAAAACGGG - Intergenic
1002220490 5:177676080-177676102 TGCCCAGAAAAACTGAAAACGGG + Intergenic
1002837963 6:881229-881251 TGCCTAAGAAAACACAGACAGGG + Intergenic
1003141599 6:3476152-3476174 AGCTCAGGAGGACTCAGAAAGGG + Intergenic
1003342433 6:5234658-5234680 TGAGTAGGAAAACACAGAAAAGG + Intronic
1008767714 6:54939829-54939851 TGCTCAGGAAGAATCAGCAAGGG + Exonic
1008770236 6:54970140-54970162 TTCCCTGGGAAGCTCAGAAAAGG + Intergenic
1008816786 6:55578659-55578681 TTTCCAGGAAAACACAGAGAAGG + Intronic
1010475406 6:76280888-76280910 TGAACAGGCAACCTCAGAAAGGG - Intergenic
1011813801 6:91164329-91164351 TTTCCTGGAAAACTCAGAATAGG - Intergenic
1012334005 6:98030932-98030954 AGCCCAGGATAACTCATATAAGG - Intergenic
1012520233 6:100112516-100112538 AGCCAAGGAAACTTCAGAAAGGG + Intergenic
1012639270 6:101588914-101588936 AGCCCAGGGAAACACAAAAATGG + Intronic
1013190444 6:107800559-107800581 TTCTCAGCAAAATTCAGAAAGGG + Intronic
1014080703 6:117282990-117283012 TTGACAGGGAAACTCAGAAAGGG + Intergenic
1014252930 6:119133351-119133373 TCCCTAGGAAGACTCCGAAATGG + Intronic
1014305071 6:119730011-119730033 TACCCAGGAAAACCATGAAAAGG - Intergenic
1014441591 6:121479851-121479873 TGCCCAGGAAAAGTCAGGAGTGG - Intergenic
1014683686 6:124467560-124467582 TTACAAGGAAAACTCAGAGAAGG + Intronic
1015549430 6:134396740-134396762 CACCAAGGAAAAATCAGAAAAGG - Intergenic
1015629751 6:135219889-135219911 TGCCCATGAGAATTCAGAATTGG - Intergenic
1015717679 6:136208897-136208919 TGAATTGGAAAACTCAGAAAGGG - Intergenic
1016495394 6:144655999-144656021 AGCACAGGAAAACTCAGCAATGG - Intronic
1016646365 6:146413271-146413293 TGTCCAGGAAAAATCAGTAAGGG - Intronic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1017444917 6:154499028-154499050 AGCCCAGGAACACACAGAAGGGG - Intronic
1017857048 6:158358977-158358999 TGCCCAGGAGAAAGCTGAAACGG - Intronic
1018132113 6:160741532-160741554 TGCCCAGGCAAAATCAGGAGTGG - Intronic
1018251215 6:161872563-161872585 TGACCAGGAAAGCCCAGAACAGG - Intronic
1019056641 6:169228278-169228300 TGTCCTGGAAAACCAAGAAAGGG + Exonic
1019758369 7:2789862-2789884 AGCCCAGGAAAGCCCAGGAAAGG + Intronic
1019781060 7:2939966-2939988 TGGCAAGAAACACTCAGAAAAGG + Intronic
1019857277 7:3621711-3621733 TCCACAGGAAGACTCAGATAAGG - Intronic
1020287916 7:6699827-6699849 AGCTCAGGAAAAGTCACAAAAGG + Intronic
1021748414 7:23768181-23768203 TGCCTATGTAAACACAGAAAAGG - Intronic
1022776874 7:33535906-33535928 TGAACAGGAAAGCTCAGACAGGG - Intronic
1023779220 7:43640561-43640583 TTCCCAGGATACCTCTGAAAGGG + Exonic
1023786034 7:43708614-43708636 TGGCCAGTAAAAATAAGAAAAGG - Intronic
1024628581 7:51229496-51229518 TGCCCTGGAAAACTCCAAGAAGG - Intronic
1024830310 7:53446457-53446479 TGACAAGGAAAAGTCAGAGAAGG - Intergenic
1026166945 7:67918607-67918629 TGCCCATGAAAACCCAGAAATGG - Intergenic
1028078527 7:86545700-86545722 TGTGGAGGAATACTCAGAAAAGG - Intergenic
1029495501 7:100894037-100894059 TGCCCAGGAAAGCAGAGACAGGG + Exonic
1030819840 7:114083116-114083138 AGCCGAGGAAAACGCTGAAAGGG - Intergenic
1030961793 7:115932147-115932169 TACTAAGGAAAACTCAGGAAGGG - Intergenic
1031313041 7:120223248-120223270 TACCTAGGAAAACACAGAGAGGG + Intergenic
1032490055 7:132317851-132317873 TGGCCAGGCAATTTCAGAAATGG + Intronic
1033019071 7:137703402-137703424 TGCTCAGGAAAAATCTGAGAAGG + Intronic
1034075009 7:148222885-148222907 TGCCCAAGACAACTGACAAAAGG - Intronic
1034620400 7:152452258-152452280 TGATCAGGAAAAATCATAAAAGG + Intergenic
1035759181 8:2056700-2056722 TGCAGAGGAAAACTCACACATGG + Intronic
1036393768 8:8349002-8349024 TGCCCAGCAAAACTTGCAAAAGG + Intronic
1037226764 8:16602148-16602170 TGCCAAGGAAAATTCAGCCAAGG + Intergenic
1038057022 8:23869312-23869334 TGCCAACATAAACTCAGAAAAGG - Intergenic
1038147025 8:24906619-24906641 TGCTCTGGAAAAATGAGAAACGG + Intergenic
1040325411 8:46339115-46339137 AGCCCAGGAAAATTCTGAGATGG - Intergenic
1041667913 8:60463852-60463874 AAACCAGGAAACCTCAGAAAAGG - Intergenic
1042261420 8:66864063-66864085 TACATAGGAAAACTTAGAAATGG + Intergenic
1043024379 8:75047936-75047958 AGCCCAGAAAAAGTGAGAAAAGG - Intergenic
1043550356 8:81364629-81364651 AGCCAAGAAAAACTCAGATAGGG + Intergenic
1045066865 8:98455686-98455708 TGCCCAGGTAAATTCCCAAAAGG - Exonic
1045287597 8:100805336-100805358 TGCACAGGAGATTTCAGAAAAGG + Intergenic
1045598957 8:103692311-103692333 TTCCCAGACAAGCTCAGAAATGG + Intronic
1047244804 8:123132216-123132238 TACTGAGGAAAACTCTGAAAAGG - Intronic
1047775547 8:128067506-128067528 TGCAGTGGGAAACTCAGAAAAGG + Intergenic
1049272317 8:141702509-141702531 TGCCCAGGAAAACCAGGGAAGGG - Intergenic
1049837779 8:144749613-144749635 TGCTCAGGTAAACCCACAAAAGG - Intronic
1051246704 9:15119057-15119079 AGCCCAGGAAAACTCCTAATAGG + Intergenic
1052223194 9:26052769-26052791 GGCCCAGGAGAACACAGGAAGGG - Intergenic
1052416835 9:28188699-28188721 AGCCAAGGAAAATGCAGAAATGG + Intronic
1055829591 9:80361985-80362007 TGCCCTGGAAATGTTAGAAAGGG - Intergenic
1056985446 9:91360592-91360614 TGCCCAAGAACCCTCACAAATGG + Intronic
1058173226 9:101707810-101707832 TTCCCAGGACAATTCTGAAAGGG - Intronic
1058817378 9:108696998-108697020 TGCTCAGCAAAACACATAAACGG - Intergenic
1058845043 9:108949155-108949177 TGCCCAGGAAAACTGCTACAAGG + Intronic
1059008922 9:110435321-110435343 TGCCCAGAGGAACTCAGTAAAGG - Exonic
1060992269 9:127856010-127856032 GGCCCATGAAAGCTCAGAGAAGG + Intergenic
1062002448 9:134223429-134223451 TGCCCAGGAAAATTGAAAACTGG - Intergenic
1062298780 9:135851874-135851896 TGCCCAGGCATACTCTGAGAGGG + Intronic
1188440073 X:30207991-30208013 TGCACTGGAAAACTCCAAAAGGG - Intergenic
1193644762 X:84054020-84054042 TGGCTAGGAAAACACTGAAAAGG + Intergenic
1193982650 X:88202711-88202733 TGCCCAGGAAAGATCTGAGAAGG + Intergenic
1194637524 X:96364002-96364024 AGACCAGGGAAACACAGAAAAGG - Intergenic
1196216319 X:113056130-113056152 GGACCAGGAAAAATCAGACAGGG - Intergenic
1197450541 X:126609357-126609379 TGTAAAGCAAAACTCAGAAATGG + Intergenic
1197706132 X:129635934-129635956 TGCACACGGAAAATCAGAAAGGG + Intergenic
1198517220 X:137421695-137421717 TGCAAAGGAAAACACAGAAAGGG + Intergenic