ID: 1150730150

View in Genome Browser
Species Human (GRCh38)
Location 17:67685782-67685804
Sequence TTTCACATACTGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150730150 Original CRISPR TTTCACATACTGAAGGTGGA TGG Intronic
900584755 1:3427468-3427490 CTTCACCTACTGGAGGTGGTGGG - Intronic
900924728 1:5697577-5697599 CTTCACAGAGTGAAGGCGGAAGG - Intergenic
901903628 1:12389516-12389538 TGTCACATAATGAAGGAGAAAGG + Intronic
902284722 1:15400021-15400043 TTTCACCTAGAGAAGCTGGAAGG - Intronic
903266330 1:22160242-22160264 CTTCACAAACTGAGCGTGGAGGG - Intergenic
907548103 1:55279849-55279871 TTTTACATACTGAAGGTTTGTGG + Intergenic
909328443 1:74382511-74382533 TTTCTCTAACTGAAGGTGAAAGG + Intronic
909928299 1:81464326-81464348 TTTCACATACTAGAGATGGGTGG - Intronic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
913141533 1:115946182-115946204 TTGCAGATACTGAAGCTGGCGGG - Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916894814 1:169151460-169151482 CTTGACCTACTGGAGGTGGAGGG + Intronic
918410298 1:184251514-184251536 ATTCACATATTGAAGGTGCATGG + Intergenic
918444390 1:184602258-184602280 TTTCACATGCTGGTGGTGGGAGG + Intronic
918840771 1:189535096-189535118 TTTCACATACTAGATTTGGAAGG - Intergenic
921315488 1:213886460-213886482 GTTCAAATATTGGAGGTGGAGGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923893018 1:238236566-238236588 TTTCATATACAGAAGCTGAATGG - Intergenic
923975053 1:239253385-239253407 TTTCAGATACTCAAGCTTGAGGG - Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924643969 1:245860063-245860085 TGTCACAGAGGGAAGGTGGAAGG - Intronic
1063545664 10:6978829-6978851 TTTAACATATTGGAAGTGGAAGG - Intergenic
1064293504 10:14056551-14056573 TTTCAGTTACAGAGGGTGGAGGG - Intronic
1066617910 10:37314586-37314608 TTTCTTTTATTGAAGGTGGAGGG + Intronic
1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG + Intergenic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1073537209 10:104288476-104288498 TTTCACATACTGCTGGTGAGGGG - Intronic
1074954489 10:118375142-118375164 TTTCATATATTTAAGGTGAATGG - Intergenic
1075395855 10:122126543-122126565 TTGCATATACAGAAGGTGGTTGG - Intronic
1076199180 10:128544848-128544870 TTTCACAATGTGGAGGTGGAGGG + Intergenic
1076250917 10:128983180-128983202 TTTCAGATACAGAGGCTGGAGGG - Intergenic
1078045252 11:7908158-7908180 CTTCTCAAACTGAAGGAGGAAGG + Intergenic
1078584309 11:12568208-12568230 TTTCACAAACTGAAGGTTCATGG - Intergenic
1078759310 11:14239045-14239067 TTTCACATTCTGAAGAATGAAGG - Intronic
1080842355 11:35996571-35996593 TTTCACAAACTGAAGGTCTATGG - Intronic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1084011648 11:66353447-66353469 TTTTACAGATTGAAGGTGGCGGG + Intronic
1085885606 11:80518283-80518305 TTCCACATACTGGGGGTGGGTGG - Intergenic
1087633547 11:100678023-100678045 TTTCTAATTCTGTAGGTGGAAGG + Intergenic
1089052661 11:115559162-115559184 TTCCACAGACTGGAGGTGCAGGG - Intergenic
1089724393 11:120462532-120462554 TTTTACAAATTGAAGGTTGATGG - Intronic
1091230253 11:133983729-133983751 TCTTACATAATGAAGGAGGAGGG - Intergenic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1093006893 12:14060915-14060937 TTTTACATAGATAAGGTGGAGGG - Intergenic
1095513521 12:42979998-42980020 TTTCACATAATTAAACTGGAAGG + Intergenic
1096648760 12:53051841-53051863 TTTCCTAGGCTGAAGGTGGAGGG - Exonic
1096983869 12:55744009-55744031 TTTAGCATACTGGGGGTGGAAGG - Intronic
1097728997 12:63106506-63106528 TTCCACAGACTGGGGGTGGAGGG + Intergenic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1104498347 12:129261884-129261906 TTTAACATAATGAATTTGGAGGG + Intronic
1105547619 13:21362371-21362393 TTTTACAAACTGAAGGTTTATGG + Intergenic
1106298827 13:28443623-28443645 TTTCATTTACTGAAGATGAAGGG + Intronic
1106795440 13:33200336-33200358 TTCCACATACAGATGGTGGGTGG - Intronic
1107096670 13:36545050-36545072 CTTCTCTTACTGAAGGTGGGTGG - Intergenic
1107215786 13:37916900-37916922 TTTCACAAACGGGAGCTGGATGG + Intergenic
1109367514 13:61375360-61375382 TTTAACATACTGAGGGATGAAGG - Intergenic
1109860130 13:68187546-68187568 TTTCATTTATTGAAGGAGGATGG - Intergenic
1111345806 13:86952132-86952154 TGTAACATAATGAAGCTGGAAGG - Intergenic
1112935458 13:104792542-104792564 TTTCAAATAATGAAAGTGCAAGG + Intergenic
1115456131 14:33605270-33605292 TTTAAAATACTGATGGCGGAAGG - Intronic
1116254756 14:42537804-42537826 ATTCACAAACTGATAGTGGAGGG + Intergenic
1116361727 14:44006810-44006832 TTTCACATTCTGTAGGTTGTTGG + Intergenic
1118227080 14:63911766-63911788 TTTCACATCCAGAATATGGAGGG + Intronic
1119143124 14:72285475-72285497 TTCCACATGATGACGGTGGAAGG - Intronic
1119392480 14:74300387-74300409 TTTCAAATGCTGAAGATGGTAGG + Intronic
1119849877 14:77859553-77859575 TGTCACTTACTGAAGGTTTAAGG + Intronic
1120427807 14:84372669-84372691 TTTCACAAATTGAAGGTTTATGG + Intergenic
1121349261 14:93160578-93160600 TTGCACATACTGATGGGGGATGG + Intergenic
1122580407 14:102768254-102768276 TTTCACATACTGAGGAAAGACGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125953826 15:43776143-43776165 TCTCAGATACTGGGGGTGGAAGG + Exonic
1126899872 15:53304232-53304254 TTCCAAATACTGAAGGGGTAAGG + Intergenic
1128014831 15:64334385-64334407 TTCCACAGACTGGGGGTGGAGGG + Intronic
1130965797 15:88696551-88696573 TCACACCTCCTGAAGGTGGATGG - Intergenic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1134151186 16:11806258-11806280 TTTCACATACTGAATGACAAAGG - Intergenic
1134265674 16:12690719-12690741 ATTCACATACTCAAGATGAACGG + Intronic
1137351242 16:47715785-47715807 AGTCACATTCTGAAGCTGGAAGG + Intergenic
1137451598 16:48579739-48579761 TCACACAGACTGAAGGTGAAGGG + Intronic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1139468661 16:67166966-67166988 AGTCACATGCTGGAGGTGGAAGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1140726237 16:77815455-77815477 TTTCACATACTGAACCCGGCTGG - Intronic
1143232781 17:5371508-5371530 TTTCATATCCAGAAGGTGGTGGG + Intronic
1144885647 17:18457728-18457750 TTTTACAAACTGAAGGTTGGTGG - Intergenic
1145146567 17:20486642-20486664 TTTTACAAACTGAAGGTTGGTGG + Intergenic
1145806334 17:27735403-27735425 TTTTACAAACTGAAGGTTGGTGG + Intergenic
1146154101 17:30505489-30505511 TTTTACAAACTGAAGGTTGGTGG + Intronic
1146828458 17:36045655-36045677 TTTCAGCTACTGAAGGTAGAGGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152402141 17:80073291-80073313 TTTTACAAATTGAAGGTTGACGG + Intronic
1152912950 17:83015865-83015887 TTTCACAGACCGATGGTGGGGGG - Intronic
1155105373 18:22660120-22660142 TTTCAAAAAATGAAGGAGGAGGG + Intergenic
1156410147 18:36820219-36820241 TTTTACTTACTGAAGGTAAAGGG - Intronic
1156519513 18:37710134-37710156 TTTCAAACCCTGAGGGTGGATGG - Intergenic
1156708641 18:39914427-39914449 GATCACAAAGTGAAGGTGGATGG - Intergenic
1157716065 18:49888264-49888286 TTTCACAAATTGAAGGTGAGAGG - Intronic
1157995872 18:52555009-52555031 TTCAAAAGACTGAAGGTGGAAGG + Intronic
1159657927 18:71055205-71055227 ATTCACTTTCTGAAGGTGGATGG - Intergenic
1164682866 19:30147275-30147297 ATCCACAAACTGAAGGTAGAGGG + Intergenic
926867718 2:17377889-17377911 TTACACAGACTGAGTGTGGAGGG - Intergenic
927078210 2:19601449-19601471 TTTCTCATGATGAATGTGGATGG + Intergenic
927204415 2:20598088-20598110 TTCCACAAACTGGAGATGGAGGG + Intronic
930485239 2:52003300-52003322 TTGCACATAATAAAAGTGGAAGG - Intergenic
930643331 2:53877131-53877153 TTTCCCCTACTGAATGTGCAAGG - Intronic
931541259 2:63331680-63331702 TTTCAAAGCCTGAAGGTGGGTGG - Intronic
932599665 2:73114787-73114809 TTCCACAGACTGAGGGTGGCAGG - Intronic
933306590 2:80607846-80607868 TTTCACATAGTGAAAGTTGAAGG + Intronic
934625510 2:95846963-95846985 TTTCAGATACTGCAGTAGGAAGG - Intronic
934808064 2:97254355-97254377 TTTCAGATACTGCAGTAGGAAGG + Intronic
934829446 2:97502832-97502854 TTTCAGATACTGCAGTAGGAAGG - Intronic
936545957 2:113393585-113393607 TTTCAGATACTGCAGTAGGAAGG + Intergenic
940425386 2:153525648-153525670 TTTCACATACTGGTGGGGGTGGG - Intergenic
940894153 2:159064342-159064364 TTTTACATACTGAAGGGGCATGG - Intronic
941262709 2:163317630-163317652 TTTCCAATACTCAAGGTGAAGGG + Intergenic
941954993 2:171195116-171195138 TTTCACATCTTTAAGGTTGAGGG - Intronic
943068750 2:183116695-183116717 TTTCACTTCCTGCAGGTGAAAGG + Intergenic
943702758 2:191004278-191004300 TTTCAAACACTGAAGTTGGAAGG + Intronic
947517594 2:230821160-230821182 TATCACCAACTGAAAGTGGAGGG + Intergenic
947653958 2:231810491-231810513 TTTCACCTGCTGAAGCTGAAGGG - Intergenic
948599271 2:239099218-239099240 TTTGAAAGACTGAAGGTGGTAGG + Intronic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1170503274 20:16996991-16997013 TTTCACATGCTGGTGCTGGAAGG - Intergenic
1170552255 20:17488181-17488203 TTTCCCAACATGAAGGTGGAAGG + Intergenic
1171085310 20:22233144-22233166 TTCTACATGCTGAAGGGGGATGG + Intergenic
1178757063 21:35361599-35361621 TTACACATTCTGTAGATGGATGG - Intronic
1181076269 22:20379393-20379415 TCACACATACTGGTGGTGGAGGG - Intronic
1185232210 22:49689764-49689786 CTTCTCACACTGAAGGTGGAGGG - Intergenic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950492373 3:13313874-13313896 TTTCACCATCTGTAGGTGGATGG + Intergenic
951307235 3:21079991-21080013 TTTCACAAATTGAAGGTTTATGG - Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951946090 3:28137997-28138019 TTTTGCAAACTGAAGGTGGTTGG + Intergenic
952011805 3:28908305-28908327 TTTCACTTCCTGCAGATGGATGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956464891 3:69509728-69509750 TTTTACAAACTGAAGGTTTATGG + Intronic
957725413 3:84058981-84059003 TTTAACATACTGAAAGAAGAGGG - Intergenic
958938825 3:100287666-100287688 TTTTTGATACTGCAGGTGGAAGG - Intronic
959532265 3:107447231-107447253 TTTCACTTACTGAATGTGAGAGG - Intergenic
960549355 3:118956865-118956887 TTTCACACATTGAAGGTTTAAGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963622240 3:147624978-147625000 TATAACAAAATGAAGGTGGAAGG - Intergenic
964822792 3:160791997-160792019 TTTCACATGCCTAAGGTAGATGG + Intronic
965146900 3:164916405-164916427 TTTTACAAATTAAAGGTGGATGG - Intergenic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
967392804 3:188973775-188973797 TTCCAAATACTGAAGGTTTATGG - Intronic
967527911 3:190515030-190515052 TTTCACAACCAGAAGGTGGAGGG - Intronic
968234409 3:197023229-197023251 TTGCTCAGACTGAAGCTGGAAGG - Intronic
969152817 4:5184862-5184884 TTTCACAAAGTGGAGGTGCACGG - Intronic
970332017 4:14996233-14996255 TTTCACAAATTGAAGGTTGGTGG + Intergenic
972417474 4:38856083-38856105 TTTGTCAAACTGAAGGTGGAAGG + Intronic
973998202 4:56481715-56481737 TTTCACATATTGAAGGTTTGTGG + Intronic
974324932 4:60401848-60401870 TTTCACATACTGGTGGTTAAGGG - Intergenic
975587416 4:75964313-75964335 ATTCCTAAACTGAAGGTGGAAGG - Intronic
977619292 4:99118574-99118596 TTTAACATACTGAAGGTCCATGG + Intergenic
979212511 4:118122307-118122329 TTTCATTTACTTAAGATGGAGGG + Intronic
979297288 4:119048206-119048228 TTGCATATATTGAAGGTGGTGGG + Intronic
981178103 4:141705941-141705963 TAACACAGACTGAAAGTGGAGGG - Intronic
981628652 4:146791229-146791251 TTTTACACATTGAAGGTGTATGG + Intronic
982239161 4:153281208-153281230 TTTCATATGCTGTGGGTGGAAGG + Intronic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
983643402 4:169965134-169965156 TCTGACATACTGAAGATGGATGG + Intergenic
983731459 4:170999091-170999113 TTTCTCATACTCAAAGTGGAAGG - Intergenic
984210652 4:176843424-176843446 TTTCAAATATTAAATGTGGAGGG - Intergenic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
985149088 4:186928143-186928165 TTTAACATACTGTAACTGGAAGG - Intergenic
986293157 5:6416486-6416508 TTTCACCTAGAGAAGGTGGAGGG - Intergenic
986337718 5:6767628-6767650 TTTCACGTCCTGCAGGTGGGAGG + Intergenic
986752788 5:10804432-10804454 TTTTACAAACTGAAGGTTGGTGG + Intergenic
989146606 5:38257082-38257104 TTCCAAATACTCAAGTTGGAGGG + Intergenic
990430892 5:55734211-55734233 TTTCAAATACTGTAGGTTGAAGG - Intronic
990435746 5:55789800-55789822 TTACCCACACTGAAGGGGGAAGG + Intronic
990489614 5:56291378-56291400 TTTAAGATATTGAAGTTGGAAGG + Intergenic
990905513 5:60798447-60798469 TTTAACTTGCTGAGGGTGGAGGG + Intronic
991468193 5:66937039-66937061 TTTCACTCATTGGAGGTGGAAGG + Intronic
999745436 5:154588253-154588275 TTTCACCTACTCAAGGCTGAGGG - Intergenic
1001452823 5:171839381-171839403 TTCAACATACTGGAGGTGGGAGG - Intergenic
1003085631 6:3058575-3058597 TTTCACATATTGAAGGTCTGTGG + Intergenic
1003402147 6:5799537-5799559 TTTCACATGCTCACGGTGGGAGG - Intergenic
1003404056 6:5814312-5814334 TTTTACAAACTGAAGGTTTATGG - Intergenic
1003532148 6:6946664-6946686 TCTCTCAGACTGAAGGGGGAGGG - Intergenic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1004487976 6:16085816-16085838 TTTCACATAGGGCTGGTGGAAGG - Intergenic
1008531068 6:52459592-52459614 TTTCACACACTGCTAGTGGAAGG + Intronic
1009507458 6:64502748-64502770 TTTCAAATACTGTTGATGGATGG - Intronic
1010382703 6:75243155-75243177 TTTCACATGCTCAAAGTCGATGG + Intronic
1012076566 6:94694088-94694110 TTTCACATACTGAACATCAAAGG - Intergenic
1012668300 6:102007440-102007462 TGTCACAAAGTGAAGGTGGCAGG - Intronic
1012965085 6:105665549-105665571 TTTCTCAAACTGAAGGTTTATGG - Intergenic
1013373482 6:109490995-109491017 TTTCACATAGGGAAGGTTTAAGG + Intergenic
1013771190 6:113629922-113629944 TTTGACATATTGAATATGGAGGG - Intergenic
1014657192 6:124121872-124121894 TTACAGGTACTGAAGATGGATGG + Intronic
1015433411 6:133156616-133156638 TTTTACAAATTGAAGGTGTATGG - Intergenic
1019781792 7:2944795-2944817 TTTCACAAAGTAAAGGTAGATGG + Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023659270 7:42456189-42456211 TCTCACCAACTCAAGGTGGAAGG - Intergenic
1024336723 7:48215554-48215576 TTTCACAAATTGAAGGTTCATGG - Intronic
1025978796 7:66391021-66391043 TTCCACAGACTGGGGGTGGAGGG + Intronic
1026250374 7:68664777-68664799 TTTGGCATATGGAAGGTGGATGG - Intergenic
1028713683 7:93939847-93939869 TTTGAGATATTGAAGGTGGGAGG - Intergenic
1028981981 7:96977367-96977389 ATTCACATATGGAAGGTGGTGGG + Intergenic
1029329395 7:99839373-99839395 GTTCACATACTGAATATGCATGG - Intronic
1030827481 7:114177338-114177360 TTTCACACATTGATGGTAGAAGG - Intronic
1033388408 7:140902094-140902116 TTTTACAAACTGAAGGTTGGTGG + Intronic
1037145946 8:15573055-15573077 TTTTACAAATTGAAGGTTGATGG - Intronic
1037300006 8:17441779-17441801 TTCCACATACTGACGGAGAAAGG + Intergenic
1037623080 8:20584109-20584131 ATTCAGATACTGAGGGTGGAGGG + Intergenic
1037987963 8:23301396-23301418 TTCCACATACTCTGGGTGGAAGG - Intronic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1041239553 8:55837903-55837925 TTTCACATAATGAAAATGGAAGG - Intergenic
1042248522 8:66732296-66732318 TTTCACAAACTCATGGTTGATGG - Intronic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1043420800 8:80096489-80096511 TTTTACAAACTGAAGGTTTATGG + Intronic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045516030 8:102862272-102862294 ATGCACATACTAAAGTTGGAGGG + Intronic
1047199668 8:122754419-122754441 TCTCACATCCTTTAGGTGGATGG + Intergenic
1050384595 9:5074339-5074361 TTTTACATATTGAAGGTTTACGG + Intronic
1050502323 9:6312006-6312028 TCTGACATTCTGCAGGTGGAAGG + Intergenic
1050565118 9:6874223-6874245 TTTTACAAACTGAAGGTCTATGG - Intronic
1052350327 9:27451974-27451996 ACTCTCATAGTGAAGGTGGACGG + Intronic
1055451163 9:76432656-76432678 TTTCACATACTGATAGCGGTAGG + Intronic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1060095279 9:120783425-120783447 TTTAAGATACTGAATGGGGAGGG - Intronic
1061121369 9:128644718-128644740 TTTCACAAACTGAAGGATCACGG + Intronic
1186849228 X:13563915-13563937 TTTCACAAACTGAAGGTTTGTGG - Intergenic
1186890977 X:13958862-13958884 TTTCAGATACTGCCTGTGGAAGG - Intergenic
1188096595 X:26031269-26031291 TTTAACATACAGAAGGTGAGTGG - Intergenic
1188279565 X:28248137-28248159 TTTCAAATACTGAATATGCACGG - Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1191961974 X:66713452-66713474 TTGCAAAAACTGAAGTTGGATGG - Intergenic
1192781746 X:74300765-74300787 TTTCAGTTTCTTAAGGTGGATGG - Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1194419376 X:93654015-93654037 TGTCAAATACTGCAAGTGGAAGG - Intergenic
1194941976 X:100021506-100021528 TTTCATATACTGAAAGTTAAAGG + Intergenic
1195743421 X:108090126-108090148 TTTTACATACTGAAAGAGAAGGG - Intronic
1196459813 X:115918385-115918407 TTTCCCTTTCTGAAGGTGGACGG + Intergenic
1198602547 X:138299895-138299917 TTTTAATTACTGAAGGTGGAAGG + Intergenic
1198918770 X:141701804-141701826 TATCACATCTTGAAGCTGGAAGG + Intergenic
1199768722 X:150959784-150959806 TTTCACACTCTGTTGGTGGAAGG + Intergenic
1200950532 Y:8894433-8894455 TGTCACATACTGCCTGTGGAGGG - Intergenic
1201332266 Y:12837295-12837317 TTTCACAGACTGAGGATGGGGGG + Intronic