ID: 1150735640

View in Genome Browser
Species Human (GRCh38)
Location 17:67735150-67735172
Sequence CTCACAAGGAACCCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150735640_1150735643 13 Left 1150735640 17:67735150-67735172 CCTGAGGCAGGGTTCCTTGTGAG 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1150735643 17:67735186-67735208 TGTATTTTCAGTGCTTAGCAAGG 0: 1
1: 1
2: 9
3: 76
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150735640 Original CRISPR CTCACAAGGAACCCTGCCTC AGG (reversed) Intronic
900387550 1:2417441-2417463 CTCACCAGGCCCCCTCCCTCCGG - Intergenic
901093162 1:6657049-6657071 CTCCTAAGGAACCATGCCTGCGG + Intronic
901879901 1:12187734-12187756 TTCACAAAGATCCCTGCCTCAGG - Intronic
906484225 1:46222013-46222035 GTCACAAGGATGCCTGCCTGAGG + Intergenic
907425061 1:54374313-54374335 CTCACAAGGAGCACAGGCTCCGG + Intronic
909136144 1:71802846-71802868 CTGGCAAGGAACTTTGCCTCAGG + Intronic
911163684 1:94706966-94706988 ATCAAAAGCAACCCAGCCTCAGG - Intergenic
911720845 1:101189691-101189713 CTGGCATTGAACCCTGCCTCTGG - Intergenic
917120632 1:171641987-171642009 CAAACAAGGTACCCTGACTCTGG - Intronic
918043683 1:180928268-180928290 CGCACAGGGAACCCAGCCTGGGG - Intronic
923462300 1:234217795-234217817 CTAAGAAGGAAGCCTTCCTCAGG + Intronic
923497003 1:234534541-234534563 CTCACAAGGACCCTGGCCCCTGG + Intergenic
924089892 1:240491413-240491435 CTCACAGGGAAGCCTTCCTGGGG + Exonic
1063295566 10:4801768-4801790 CTCCCAGGGAACCATGCCACAGG - Intronic
1070020259 10:72578329-72578351 CTCACAGCAAACTCTGCCTCTGG + Intronic
1070986766 10:80696223-80696245 CTCACAAGCGACTCTGCTTCTGG + Intergenic
1071298177 10:84237578-84237600 CTCGCCAGGAACCCTGCGTATGG + Exonic
1076060833 10:127412796-127412818 CACACAAGGAATCTGGCCTCGGG - Intronic
1076186159 10:128451051-128451073 CTGACTAGGATACCTGCCTCAGG + Intergenic
1076285795 10:129295251-129295273 CTCACGAGGAGCCCTTCCGCTGG + Intergenic
1077047748 11:553846-553868 CCCCCAAGGACCACTGCCTCGGG + Intronic
1079642436 11:22823619-22823641 CTCCCAAGGAAAACTGCCTGGGG - Intronic
1087076687 11:94132415-94132437 CACACTTGGAATCCTGCCTCAGG - Intronic
1089926867 11:122267942-122267964 CTCACCAGAAACCTTGTCTCTGG + Intergenic
1089973959 11:122716607-122716629 CCCACAGGCAACCTTGCCTCAGG - Intronic
1090978837 11:131698739-131698761 CTAACAAGGAAGCCTGGCACTGG - Intronic
1091297959 11:134486928-134486950 CTCACCAGGAAGCCTGCCCCTGG - Intergenic
1092153056 12:6264329-6264351 CCCACAAGAAAGCCTGCCCCTGG - Intergenic
1092904286 12:13087951-13087973 CTCACTGGGAACCCTGCCTGTGG - Exonic
1095464652 12:42477537-42477559 CTCACAAATAACCCTTCCTTAGG + Intronic
1097803543 12:63940807-63940829 CTCACAAGGGCACCTGCCTCAGG + Intronic
1098487598 12:71039750-71039772 CTCAAAAGGAGCCCTGTGTCTGG - Intergenic
1100371882 12:93976074-93976096 CTCACCAGTCCCCCTGCCTCTGG + Intergenic
1104762346 12:131305090-131305112 CCCACAATGAACCCGGCCACAGG + Intergenic
1104817430 12:131655706-131655728 CCCACAATGAACCCGGCCACAGG - Intergenic
1106770641 13:32957897-32957919 CTAACAAGGGCCCCTGCCTGAGG - Intergenic
1106879163 13:34110324-34110346 CTCACCAGGACCACTGCCTCAGG - Intergenic
1108583298 13:51845676-51845698 CTCACAAAGCAGCCTGCTTCAGG - Intergenic
1109496230 13:63176539-63176561 CTCACAAGGAACCCCATGTCAGG - Intergenic
1111939216 13:94591517-94591539 CTCACTGCGACCCCTGCCTCCGG - Intronic
1113939331 13:114010393-114010415 CTCACCAGGAGCACTGCCCCCGG + Intronic
1114621245 14:24097659-24097681 CTCACAACAACCTCTGCCTCCGG + Intronic
1118930325 14:70234702-70234724 ATCACCGGGAACCCTGCATCCGG - Intergenic
1121785213 14:96653628-96653650 CTCACAGCAAACTCTGCCTCCGG + Intergenic
1123496781 15:20834473-20834495 CAGACAAGGAACCCTGGCTTGGG - Intergenic
1123554014 15:21408065-21408087 CAGACAAGGAACCCTGGCTTGGG - Intergenic
1123590260 15:21845430-21845452 CAGACAAGGAACCCTGGCTTGGG - Intergenic
1124481290 15:30082790-30082812 CTCACAAGGAAAGCTGCCCATGG - Intergenic
1124487745 15:30134886-30134908 CTCACAAGGAAAGCTGCCCATGG - Intergenic
1124522308 15:30414403-30414425 CTCACAAGGAAAGCTGCCCATGG + Intergenic
1124536356 15:30551815-30551837 CTCACAAGGAAAGCTGCCCGTGG - Intergenic
1124542835 15:30603863-30603885 CTCACAAGGAAAGCTGCCCATGG - Intergenic
1124755783 15:32403435-32403457 CTCACAAGGAAAGCTGCCCATGG + Intergenic
1124762295 15:32455777-32455799 CTCACAAGGAAAGCTGCCCATGG + Intergenic
1124776336 15:32593293-32593315 CTCACAAGGAAAGCTGCCCATGG - Intergenic
1124904087 15:33852236-33852258 CTTACAAGGAACCCCCCCACAGG + Intronic
1125261100 15:37825389-37825411 GTCACAGAGAACCATGCCTCTGG - Intergenic
1125451159 15:39809014-39809036 CTCACAGGGAACCAGTCCTCAGG + Intronic
1126096786 15:45095799-45095821 GTCACTGGGAACCCTGCTTCCGG - Intronic
1126680126 15:51193972-51193994 CACCCCAGGAACCCTGCCTTAGG - Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1129256037 15:74334665-74334687 CACACAATGAACCCTGACCCTGG - Intronic
1129324096 15:74790445-74790467 CTCACAAGAAAGGCTGCCTGAGG + Intronic
1202962362 15_KI270727v1_random:135261-135283 CAGACAAGGAACCCTGGCTTGGG - Intergenic
1132634166 16:934960-934982 CGCATGAGGAGCCCTGCCTCAGG + Intronic
1135588928 16:23691516-23691538 CTGACAAGGATCATTGCCTCTGG + Intronic
1135738344 16:24951937-24951959 CTCAAAAGGCACACTGCCACGGG + Intronic
1136653801 16:31696579-31696601 CTCACAGGGCACCCTGCCCCAGG + Intergenic
1138282243 16:55780839-55780861 CTCACAAAGGTCTCTGCCTCCGG + Intergenic
1139129441 16:64123248-64123270 TTCACAAGAAACCCTGTCTCAGG + Intergenic
1139324952 16:66145533-66145555 CTCACTGCGAGCCCTGCCTCTGG + Intergenic
1139712195 16:68784493-68784515 CCCACATGGACCCCTCCCTCTGG + Intronic
1141848790 16:86629968-86629990 CACACAAAGACACCTGCCTCAGG - Intergenic
1143775813 17:9198094-9198116 CACACAAGAATCCCTGTCTCGGG - Intronic
1145093306 17:20003617-20003639 GTAACCAGGAATCCTGCCTCAGG - Intergenic
1147320832 17:39644988-39645010 CTAGCAAGGAACCCTGTCTGTGG + Intronic
1150735640 17:67735150-67735172 CTCACAAGGAACCCTGCCTCAGG - Intronic
1152001182 17:77646173-77646195 CCCACTCGGAACCCGGCCTCGGG - Intergenic
1152088294 17:78233315-78233337 ATTACAAGGACCCCTGCCTGAGG + Intronic
1152112874 17:78366717-78366739 CTCAGAAGGAAGCCTGCGCCCGG - Intergenic
1152555695 17:81052154-81052176 CTCACCATGGGCCCTGCCTCGGG + Intronic
1160733067 19:649861-649883 CTCACCAGGGACCCTGGCTGGGG + Intronic
1160733104 19:649953-649975 CTCACCAGGGACCCTGGCTGGGG + Intronic
1160733181 19:650137-650159 CTCACCAGGGACCCTGGCTGGGG + Intronic
1161087117 19:2340403-2340425 GTCCCCAGGAACCCTGCCCCAGG + Intronic
1161345119 19:3765085-3765107 CTCTCACAGAACCCTGTCTCAGG - Intronic
1162800307 19:13106549-13106571 CTCACTACAAACTCTGCCTCAGG + Intronic
1163700513 19:18784487-18784509 CCCACAAGGAAGCCTTCTTCAGG + Intronic
1163711284 19:18848605-18848627 AGCACAAGTAAGCCTGCCTCCGG - Intronic
1164464284 19:28474428-28474450 CTCACTGGAAACTCTGCCTCCGG + Intergenic
1167117826 19:47498305-47498327 CTCACAAGGCACCCGGCCAAGGG + Intronic
926076999 2:9950551-9950573 CACACCAGGGTCCCTGCCTCAGG + Intergenic
926446704 2:12951464-12951486 CTGAAAAGGAACTTTGCCTCAGG + Intergenic
926503540 2:13683062-13683084 ACCACAAGGAACACTGCCCCTGG + Intergenic
927578625 2:24221765-24221787 GTCACAAGCAACCTTGCATCAGG + Intronic
932767622 2:74481524-74481546 CCCACTAGCATCCCTGCCTCAGG - Exonic
936034263 2:109098080-109098102 ATCACCAGGATCCCTTCCTCAGG + Intergenic
937264599 2:120607951-120607973 CTCACAAGGTTCCCTGGCCCAGG - Intergenic
940420656 2:153477147-153477169 CTGAGAAGGAGCCCAGCCTCAGG - Intergenic
942076755 2:172363205-172363227 CTCACAAGGAAAGCGGCTTCAGG - Intergenic
943776774 2:191774527-191774549 CTCAGTAGGAACCCTGCATGGGG - Intergenic
946768405 2:223061703-223061725 CTCACAAGCATCAATGCCTCTGG + Intronic
948259212 2:236590488-236590510 CTCAGAATGAAACCTCCCTCGGG - Intergenic
948570049 2:238912344-238912366 CTCACCAGGAAACCAGGCTCAGG - Intergenic
1169824551 20:9752937-9752959 CTCACTTGGAACCCTGTCACTGG + Intronic
1170421438 20:16197350-16197372 GTCTCAAGCAACCCTGCCTAGGG - Intergenic
1172076419 20:32301449-32301471 CTCACTGCAAACCCTGCCTCTGG + Intronic
1173023300 20:39285761-39285783 TGCCCAAGAAACCCTGCCTCAGG - Intergenic
1173433599 20:43012978-43013000 TTCACAGGAATCCCTGCCTCAGG + Intronic
1174104835 20:48154805-48154827 CTCACAAGGAGCAGTGTCTCGGG - Intergenic
1175166389 20:57047490-57047512 CTCAGCAGGAATCCTGCCCCTGG + Intergenic
1176184227 20:63769365-63769387 CTCACAAGGGACCCAGGCCCTGG + Intronic
1176819479 21:13643151-13643173 CAGACAAGGAACCCTGGCTTGGG + Intergenic
1177742745 21:25173570-25173592 TCCACAAGGAACACCGCCTCTGG + Intergenic
1178910812 21:36671781-36671803 CCCACATGGGACCCTGCCTCGGG - Intergenic
1179953296 21:44723823-44723845 CGCAGAAGGAAGCCTGGCTCAGG + Intergenic
1181130207 22:20726766-20726788 CTCACTAGGGAGCCTGCCTCAGG + Intronic
1183521354 22:38297826-38297848 CTCCCAAGAAACACTTCCTCAGG + Intronic
1183703488 22:39463017-39463039 CTCACTTAGAACCCTGTCTCTGG - Intronic
1184781265 22:46650834-46650856 CTCACAAGGAAGAGTGACTCTGG - Intronic
1184945658 22:47802065-47802087 CTCCCCAGGCACCCTCCCTCTGG + Intergenic
950426900 3:12929239-12929261 CTCATAACGTACCATGCCTCAGG + Intronic
950437034 3:12986323-12986345 CTGACAAGGCACATTGCCTCTGG - Intronic
951267582 3:20587891-20587913 CACAGAGGGAATCCTGCCTCTGG - Intergenic
952298953 3:32086974-32086996 ATCACAAGAAACCCTGCGCCTGG + Intergenic
953938338 3:47067133-47067155 CTCACTAATAACCCTCCCTCTGG - Intronic
956905281 3:73759089-73759111 CTCACAAATTACCCAGCCTCAGG + Intergenic
957522563 3:81338048-81338070 GTCACATGGAACTATGCCTCAGG + Intergenic
960991307 3:123313401-123313423 CTCACTAGGAGCCAAGCCTCTGG - Intronic
964354544 3:155838227-155838249 CTCACCACAACCCCTGCCTCCGG - Intronic
968645681 4:1739572-1739594 CCCACATGGAACTGTGCCTCTGG + Intronic
969242447 4:5908995-5909017 CTAACCAGGCTCCCTGCCTCAGG + Intronic
969893090 4:10277808-10277830 CTCATAAGGAACACTGCCCACGG - Intergenic
971253068 4:24989327-24989349 CTCACAGGGAAGCATGTCTCTGG - Intergenic
972944984 4:44242984-44243006 CTTACAAAGCACCCAGCCTCAGG + Intronic
979091551 4:116489624-116489646 CTCGCAAGTAACACTCCCTCAGG - Intergenic
987278773 5:16390552-16390574 TTCACAAGTAACTCTTCCTCTGG + Intergenic
988454578 5:31375798-31375820 CACTTAAGAAACCCTGCCTCAGG - Intergenic
992506656 5:77393849-77393871 CTTACAAGGTTCCCGGCCTCTGG - Intronic
993870205 5:93243945-93243967 CTGACAGGGAATCCTTCCTCTGG + Intergenic
994320360 5:98387572-98387594 CTCACTATAACCCCTGCCTCTGG + Intergenic
997588915 5:135061146-135061168 CTGAGAAGGAGCCCTGCCCCAGG - Intronic
998395029 5:141812703-141812725 CCCACCTGGAACCCTGCCTTGGG - Intergenic
999382961 5:151134651-151134673 ATCAAAAGGGACCCTCCCTCTGG + Intronic
1002656132 5:180748930-180748952 CTCAGCAGCAATCCTGCCTCAGG + Intergenic
1003761689 6:9185615-9185637 CTCACAAGGATTCCATCCTCTGG + Intergenic
1007214586 6:40227534-40227556 CCCAGAAGGAACCCTGCTGCAGG - Intergenic
1007388122 6:41532993-41533015 CTCAGAAGGAACCTTGCTTTTGG + Intergenic
1009413420 6:63392398-63392420 CTCCAAAGGGACCCTGTCTCAGG + Intergenic
1010498461 6:76566005-76566027 CTTGTAAGGAACCCAGCCTCAGG - Intergenic
1017528427 6:155263610-155263632 CTCACAAGGGACCCGGGCTAAGG + Intronic
1017822563 6:158060065-158060087 CCCACAGGGCACCCGGCCTCAGG + Intronic
1018811805 6:167303857-167303879 CTTGCCAGGCACCCTGCCTCTGG + Intronic
1018869442 6:167770025-167770047 CTGGCTAGGAACCCTGACTCCGG + Intergenic
1021706601 7:23374063-23374085 TTTACAAGGTACCCAGCCTCAGG + Intronic
1021915914 7:25432106-25432128 CTCCTTAGGAACCCTACCTCAGG - Intergenic
1023316927 7:38947708-38947730 ATCACAAGAAACACTGCCCCTGG + Intergenic
1024012369 7:45279906-45279928 CTCAGATGGAATCCTGCCACAGG + Intergenic
1024762215 7:52612337-52612359 CTCAGAAGAAACCCTGCTTGTGG - Intergenic
1025718442 7:63985789-63985811 CTCACCACAAACTCTGCCTCTGG - Intergenic
1032187577 7:129740457-129740479 CCCACAAGGATCCCTACTTCGGG + Intronic
1034697509 7:153066877-153066899 CTCACGCGGATCCCTTCCTCAGG - Intergenic
1034944669 7:155254082-155254104 TTTAGAAGGAACCCAGCCTCTGG + Intergenic
1035038127 7:155908545-155908567 CTACCCAGGGACCCTGCCTCGGG - Intergenic
1036748078 8:11424257-11424279 GTCCCAGGGACCCCTGCCTCCGG + Exonic
1036769161 8:11566883-11566905 CTCACCCGGAACCCTGGCACTGG - Intergenic
1042692153 8:71511882-71511904 CCCATACGGAAGCCTGCCTCTGG - Intronic
1044529512 8:93291403-93291425 TTCACAAACAACCCTGTCTCAGG - Intergenic
1046853403 8:119001432-119001454 CTAGCAAGAAACCCTGTCTCTGG + Intronic
1047796101 8:128257554-128257576 CCCACAGGGAATCCTGCCGCTGG + Intergenic
1049403651 8:142442183-142442205 CCCCAAGGGAACCCTGCCTCAGG + Intergenic
1054813224 9:69451300-69451322 GTGACAAGAATCCCTGCCTCAGG + Intronic
1056681539 9:88723303-88723325 CTCACAAAACACCCAGCCTCTGG - Intergenic
1062055965 9:134469958-134469980 CTCAGGAGGAACCCAGGCTCAGG - Intergenic
1203527879 Un_GL000213v1:106419-106441 CAGACAAGGAACCCTGGCTTGGG - Intergenic
1185578653 X:1193448-1193470 CTCCCCAGGGACCCTGCCTCTGG + Intronic
1186962488 X:14751671-14751693 CTCACAAGTACCACAGCCTCTGG + Intergenic
1188723560 X:33552093-33552115 CTCTCCAGGAACTCTGTCTCAGG + Intergenic
1198268272 X:135031258-135031280 CTGACAAGAAACCCTCCCACAGG + Intergenic
1198806318 X:140499012-140499034 CTCAAAAGGAATCCTGGCTGAGG + Intergenic
1200079048 X:153566522-153566544 GTCTCAAGGGACCCAGCCTCAGG + Intronic
1200771041 Y:7125696-7125718 CACACAAGCAACCCTGACTCAGG + Intergenic
1202350860 Y:23989527-23989549 CTCACTGTGAACTCTGCCTCCGG + Intergenic
1202519919 Y:25680592-25680614 CTCACTGTGAACTCTGCCTCCGG - Intergenic