ID: 1150735834

View in Genome Browser
Species Human (GRCh38)
Location 17:67738296-67738318
Sequence TGCTCTCCTTTGTTTCGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150735834_1150735835 -8 Left 1150735834 17:67738296-67738318 CCAGGACGAAACAAAGGAGAGCA 0: 1
1: 0
2: 2
3: 18
4: 127
Right 1150735835 17:67738311-67738333 GGAGAGCACTTCATGCCCTGTGG 0: 1
1: 0
2: 2
3: 16
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150735834 Original CRISPR TGCTCTCCTTTGTTTCGTCC TGG (reversed) Exonic
900037200 1:424477-424499 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
900058830 1:660218-660240 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
903343308 1:22668449-22668471 TGGCCTCCTTTGTTCCCTCCTGG - Intergenic
906301592 1:44686003-44686025 TGTACTCCCTTGTTTTGTCCTGG - Intronic
906608811 1:47188480-47188502 TGCTGACCTGTGTTTTGTCCTGG - Intronic
907742416 1:57179975-57179997 TTCTTTCCTTTTTTTCATCCCGG - Intronic
912505916 1:110156021-110156043 TGCTCTCCTTCCTTTAGACCTGG - Intronic
915075627 1:153306429-153306451 TGCCCTCCCTTGTTTCTTGCGGG + Intronic
915775427 1:158479856-158479878 TGCACTCCTTTGTTCCTTTCAGG - Exonic
919194172 1:194262871-194262893 TGTTCTCTTTTTTTACGTCCAGG - Intergenic
919794730 1:201314580-201314602 TGGTCTCCTTTGTTTCCTCTGGG - Intronic
1064991745 10:21262497-21262519 TGCTTTCCTTCGTTTCTCCCTGG - Intergenic
1065875440 10:29993617-29993639 TTCTCTCCTTTGTTTCATCCTGG - Intergenic
1066530515 10:36333084-36333106 TGGTCTCCTTATTTTCTTCCAGG + Intergenic
1070671206 10:78378521-78378543 TGCTCTCCCTTCTTTTGTCCTGG + Intergenic
1072780254 10:98245956-98245978 TGCTCTGCTTTGATTCTTCAAGG + Intergenic
1072977446 10:100071358-100071380 TCCCCTTCTTTGTTTCTTCCAGG + Intronic
1076576706 10:131474354-131474376 CGCTCTCCTTTGTTTCCTGCTGG - Intergenic
1076963927 11:62400-62422 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
1078758884 11:14235858-14235880 CTCTCTCCTTTGTTTCCTCCAGG - Intronic
1081020743 11:37945855-37945877 TGCTCTCTTTTGTTTCATCTAGG + Intergenic
1081133089 11:39404395-39404417 TGCTCCCATTTTTTTCCTCCAGG + Intergenic
1081260387 11:40952925-40952947 TTCTCTCTTTTCTTTTGTCCAGG + Intronic
1082014904 11:47477855-47477877 TGTTCTCCCTTGTTTGCTCCTGG - Intronic
1084714374 11:70864305-70864327 TTCTCTCCTTTCTTTTGCCCTGG - Intronic
1084898205 11:72291221-72291243 TGATGTCCTTTGTCTGGTCCAGG - Intergenic
1090145035 11:124312430-124312452 AGCTCTGCTGTGTTTCCTCCTGG - Intergenic
1091397347 12:162097-162119 TCCTTTCCTTTCTTTCTTCCTGG + Intronic
1092805525 12:12218846-12218868 TGCTATTCTTTGTCTCTTCCTGG - Intronic
1093113934 12:15186522-15186544 TGCTCTTCTTCTTTTCTTCCTGG - Intronic
1093807455 12:23452018-23452040 TGCTCTCCTATTTTTCTACCTGG + Intergenic
1097461370 12:59867322-59867344 TTTTCTCCTTTGCTTCTTCCTGG + Intergenic
1098205544 12:68105546-68105568 TCCTCTCCTTTATTTCCTACCGG + Intergenic
1103026341 12:117577175-117577197 TGCTCTTCCTTGTCTAGTCCAGG - Intronic
1104527876 12:129541093-129541115 TGCTTTGCTTTGTTTCTTCATGG - Intronic
1107989859 13:45810196-45810218 TGATCTCCTTTGGGTAGTCCAGG - Intronic
1108180834 13:47838198-47838220 TCCTCTCCTTTGTTTCCTGAGGG + Intergenic
1110281134 13:73695671-73695693 TGTGTTCCTTTGTTTCTTCCAGG - Exonic
1110723696 13:78795091-78795113 TGCTCTCCTTGACTTTGTCCAGG + Intergenic
1113840996 13:113361436-113361458 TGCTGTCCTTTTCTTCGACCAGG - Intronic
1113948782 13:114059732-114059754 TGCTCCCCGTTGTTTGGTCCTGG - Intronic
1114960548 14:27882986-27883008 TGCTCTCCATAGTTTCTCCCTGG + Intergenic
1121503348 14:94457857-94457879 TGCTCTCCTTTATTTCCTAAAGG + Intergenic
1124690326 15:31816261-31816283 ATATCTCCTTTGTTTAGTCCAGG - Intronic
1125561155 15:40634731-40634753 TGCTCTCCTCTGTTTGGTCTTGG - Intronic
1128102196 15:65011537-65011559 TGCACTACTGTGTTTCATCCTGG - Intronic
1128905324 15:71462712-71462734 GGGTCTCCTTAGTTTCTTCCAGG + Intronic
1131568781 15:93510759-93510781 TGCACTCCATTCTTTCATCCAGG - Intergenic
1132301906 15:100781272-100781294 TTCTCACCTTTGTTTTGTCCAGG + Intergenic
1132444625 15:101902777-101902799 TGTTCTCCTTTATTTCCTGCTGG - Intergenic
1137498889 16:48995416-48995438 TGCTGTTCTTTGATCCGTCCTGG + Intergenic
1140337191 16:74118700-74118722 TCCTCTCCTCTCTTTCTTCCTGG - Intergenic
1143425226 17:6831123-6831145 TTCTCTCCTTTTCTTTGTCCTGG - Intronic
1150735834 17:67738296-67738318 TGCTCTCCTTTGTTTCGTCCTGG - Exonic
1154168425 18:12033510-12033532 TACTCTCCTAGGTGTCGTCCTGG - Intergenic
1154996581 18:21646302-21646324 TGCTCTCCTTTTTTTCCCCGGGG - Intergenic
1157632911 18:49117786-49117808 TGCTCTCCTTTGGTTAAGCCTGG + Intronic
1160640730 19:132032-132054 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1163417404 19:17194997-17195019 TGCTCTCCTTTTTGTCTTCCAGG - Exonic
1166249277 19:41555992-41556014 TGCTCTCTTTTATTTCATCTTGG - Intronic
1167699884 19:51036469-51036491 TGCTCTCCTCTGTTTTGTTCTGG - Intergenic
925073848 2:994263-994285 TTCTCTCCTTTGAATTGTCCTGG + Intronic
927244804 2:20949089-20949111 TGCTCTCCTTTGTTTTTTGGTGG + Intergenic
932211219 2:69932374-69932396 TGCTCTCCTGTGGTTGGCCCGGG + Intronic
932337096 2:70937721-70937743 TGCTCTGCTTTCCTTCTTCCTGG + Intronic
933640841 2:84757848-84757870 TCCTGTCCTTTGATTTGTCCCGG - Intronic
936504442 2:113093979-113094001 TGCTCACTTTTGCTTCCTCCTGG + Intergenic
939829962 2:147060033-147060055 TACTCTCCTTTCATTCCTCCAGG + Intergenic
940508112 2:154581581-154581603 TGCTCTCCTTTGTGAGCTCCAGG - Intergenic
942048026 2:172111672-172111694 TGCTCTGCTATATTTTGTCCAGG + Intergenic
942588911 2:177519222-177519244 TACTCTCCTTTGTTATCTCCTGG + Intronic
943820401 2:192314680-192314702 TGCTCTGCTTTGTCTCAGCCTGG + Intergenic
947577515 2:231287554-231287576 TGCTCTCCTTCCTTTCGACGGGG + Intronic
1170292476 20:14785882-14785904 TGCTCCCCCTTTTTTCTTCCTGG - Intronic
1171146509 20:22788395-22788417 TGCACTCTCTTGTTTCTTCCAGG - Intergenic
1173758085 20:45535655-45535677 AGCTCTCCTTTATTTCCTTCCGG + Intronic
1180884185 22:19228207-19228229 TCCTATCCTTTGTTTCCTTCAGG + Intronic
1182003493 22:26940137-26940159 TTCACTCCTTTGTTTCTTTCAGG - Intergenic
1182003700 22:26941697-26941719 TTCACTCCTTTGTTTCTTTCAGG + Intergenic
1182414824 22:30214606-30214628 TGCTCTCCTTTCCTCCTTCCAGG - Intergenic
1185187752 22:49413125-49413147 GGCTTCCCGTTGTTTCGTCCTGG - Intergenic
949269692 3:2200400-2200422 TGCTCCTCTCTGTTTCCTCCCGG + Intronic
949820179 3:8107594-8107616 TGCTCTCCTTTTTTTGGTACTGG + Intergenic
955597058 3:60602634-60602656 TTCTCCCATTTGTTTAGTCCTGG - Intronic
956567601 3:70656386-70656408 TGCTTTCCTTTGTTTCTACCTGG - Intergenic
958771618 3:98432957-98432979 TGCTCTTCTGTGTTTCTTCCTGG - Intergenic
960346019 3:116534278-116534300 GGCTTTCCTTTGTTTTCTCCTGG - Intronic
963273342 3:143306891-143306913 TTCTCTTCTTTCTTTCCTCCTGG + Intronic
965057214 3:163736451-163736473 TGTTCCCCTTTTTTTTGTCCTGG - Intergenic
967454962 3:189674426-189674448 TGCTCCCCTTTCTTGCTTCCTGG - Intronic
969514400 4:7638468-7638490 TGCTCTCCTTTGTGTAGGCGAGG - Exonic
973122047 4:46533417-46533439 TGTTATCCTTGGTTTTGTCCTGG + Intergenic
973122629 4:46541632-46541654 TGTTATCCTTGGTTTTGTCCTGG - Intergenic
976208153 4:82641421-82641443 TTCTCTGCTTTTTTTCTTCCTGG - Intronic
982447757 4:155513722-155513744 TGGTTTCCTTTGTTTTGTCTTGG + Intergenic
983875887 4:172874259-172874281 TGCTCTCCCCTCTTTAGTCCAGG - Intronic
988191350 5:27939999-27940021 TGGTCCTCTTTGTTTCCTCCTGG + Intergenic
990249392 5:53897277-53897299 TACTCTACTTTGTTTCTTCATGG + Intronic
995840465 5:116438944-116438966 TTCTCTGCTTTGATTCATCCTGG + Intergenic
998581675 5:143383591-143383613 TGCTTTCCTTTATGTAGTCCAGG - Intronic
1000094829 5:157962521-157962543 TGCTCTTCTTTGTGTTGGCCGGG + Intergenic
1001692690 5:173644592-173644614 TGCCCTCCTTTGTTTCTCCCCGG - Intergenic
1001913342 5:175539238-175539260 TGTTATCCTTGGTTTCATCCTGG - Intergenic
1002736621 5:181394389-181394411 TGTTCTCCTTTATTTCCTGCTGG - Intergenic
1002748078 6:80435-80457 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
1003888863 6:10545690-10545712 TGCTTTCCTGAGTTTAGTCCTGG + Intronic
1005174378 6:23027231-23027253 TGCCCTCCTCTGCTTCTTCCAGG - Intergenic
1008285357 6:49642877-49642899 TTCTCTCTTTTCTTTCGTCTTGG + Intergenic
1011044219 6:83064522-83064544 TACTCTCCTTTGTTTAGGCAAGG - Intronic
1015154982 6:130083038-130083060 TGCCCTCTTTTGTTCCCTCCAGG - Intronic
1015717134 6:136204555-136204577 TGCTCTACTTTGTTTCCTCTGGG - Intergenic
1018453054 6:163926791-163926813 TTGTCTCCTTGGTTTTGTCCAGG + Intergenic
1018619756 6:165718652-165718674 CACTCTCCTGTGTCTCGTCCGGG - Intronic
1018957085 6:168417365-168417387 TGCTCTCCTTTGCTTCTTCCTGG - Intergenic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1019241719 6:170669918-170669940 TGTTCTCCTTTATTTCCTGCTGG - Intergenic
1026407032 7:70077055-70077077 TGCTCTCCCCTGTGTCCTCCAGG - Intronic
1030012317 7:105182290-105182312 TGCTATCCTTTTTTACGTCAGGG - Intronic
1030599302 7:111574701-111574723 TGCTGACCTTTGTTTCTTCTAGG - Intergenic
1031963221 7:128008410-128008432 AGCACTCCTTGGTTTCCTCCGGG - Intronic
1032615756 7:133468723-133468745 TGTGCTCCGTTGTTTCTTCCAGG + Intronic
1035025416 7:155821873-155821895 TGATCTCTTTTGTGTCTTCCAGG + Intergenic
1035506397 8:138178-138200 TGTTCTCCTTTATTTCCTGCTGG + Intergenic
1037263179 8:17030203-17030225 TGCATTGCTTTGTTTCTTCCAGG + Intronic
1041044416 8:53877774-53877796 TGCTGTCGTTTGTTTGCTCCTGG - Intronic
1041432905 8:57804474-57804496 TGCTTTCCTTTATTTTCTCCTGG - Intergenic
1048482152 8:134808226-134808248 TGCTCGTCTTTGTTTCTCCCAGG - Intergenic
1050699054 9:8316366-8316388 TGCTGTACTTTGTTTCGTTTTGG - Exonic
1051465429 9:17371292-17371314 TGCTCTTCTTTGGTTTGTACTGG - Intronic
1062520398 9:136955293-136955315 TGCCCTCCCTTGCTTCCTCCTGG + Intronic
1203601910 Un_KI270748v1:19152-19174 TGTTCTCCTTTATTTCCTGCTGG - Intergenic
1187497434 X:19807565-19807587 TCCTCTCCTGTGTTTCTTCATGG + Intronic
1187515938 X:19970217-19970239 TGCTCACCTGTGTTTCCACCTGG + Exonic
1187734066 X:22286408-22286430 TTCTCCCCTGTGTTTTGTCCAGG + Intergenic
1188873677 X:35404098-35404120 TGCTCTCCTTTGTTATTTCTGGG + Intergenic
1195024449 X:100862272-100862294 TGCTCTCCTCTGTTTGACCCCGG + Exonic
1195423565 X:104702407-104702429 TGCTTTCCTTTCCTTCTTCCTGG - Intronic
1195492105 X:105482998-105483020 TCCTCTCATTTCTTTCTTCCAGG + Intronic
1199016554 X:142822641-142822663 TGCTCTTCTTTGTTTGATCTCGG + Intergenic
1199571604 X:149272268-149272290 TGCTCTCCTTTGTGTCCTCAAGG + Intergenic
1199667899 X:150116070-150116092 TGGTCTCCTTTGTCTTGTCCTGG - Intergenic
1201856915 Y:18554818-18554840 TGCTCTCCTCTGCTTTCTCCAGG + Intronic
1201876406 Y:18765562-18765584 TGCTCTCCTCTGCTTTCTCCAGG - Intronic
1202170342 Y:22036735-22036757 TGCTCTCCTCTGCTTTCTCCGGG - Intergenic
1202221023 Y:22549638-22549660 TGCTCTCCTCTGCTTTCTCCGGG + Intergenic
1202322089 Y:23646025-23646047 TGCTCTCCTCTGCTTTCTCCGGG - Intergenic
1202548678 Y:26024031-26024053 TGCTCTCCTCTGCTTTCTCCGGG + Intergenic