ID: 1150747772

View in Genome Browser
Species Human (GRCh38)
Location 17:67829948-67829970
Sequence CCTTTTATGGAAAAAATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 2, 1: 0, 2: 3, 3: 26, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150747772 Original CRISPR CCTTTTATGGAAAAAATGTA AGG Intronic
901782903 1:11606084-11606106 CCTTGCATTTAAAAAATGTATGG + Intergenic
903294086 1:22332640-22332662 ACTTTTCTGGAACAAATCTAGGG + Intergenic
906818629 1:48905310-48905332 CCACTTATGGTAAAAATTTAGGG + Intronic
907282528 1:53360494-53360516 CCTTTATTGGAAAAAAAGTGAGG - Intergenic
907933762 1:59023464-59023486 CCTTGTATGGAAATCATGTCTGG + Intergenic
908281803 1:62546661-62546683 CATTTTAAGAAAAATATGTATGG - Intronic
908389914 1:63675104-63675126 CTTTTTATTGAGAAAAGGTAAGG - Intergenic
909154069 1:72048518-72048540 CCTTTTGGGGAAAAAATGCTGGG - Intronic
909393364 1:75139552-75139574 CATTTTAGGAAAAAAATATAAGG + Intronic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
911077070 1:93886838-93886860 ACTTATATGAAAAAAATGTTGGG + Exonic
911223967 1:95283940-95283962 GATTTCATGGACAAAATGTATGG + Intergenic
913272752 1:117110128-117110150 CCATTTTTAGAAAAAAAGTAGGG + Intergenic
915906914 1:159885571-159885593 CCTTTTCTGCACAAAATGAAGGG + Intronic
916828646 1:168468230-168468252 CCATTCATGGAAAGAATGTCTGG + Intergenic
916842987 1:168619330-168619352 CCTCTTATGGAAAAAATCCCTGG + Intergenic
916898184 1:169189144-169189166 CCTTTTTTAGTAAAAATGTAAGG - Intronic
917072941 1:171172471-171172493 CCTTTTATAGATAAAATAAAGGG - Intergenic
917740643 1:177958974-177958996 CCCTACATGGAAAAAATTTAGGG + Exonic
917785467 1:178451737-178451759 CCTTTACATGAAAAAATGTAAGG - Intronic
918256659 1:182754631-182754653 ACTTTTATGGAACAATTTTATGG - Intergenic
918981530 1:191566555-191566577 CCTTTTATTAAAAAAATTAATGG - Intergenic
919331610 1:196179362-196179384 GATTTTATGGAAAAAAAATATGG - Intergenic
921354401 1:214272847-214272869 ACTGTTATGGAAGAAATGTTTGG + Intergenic
921611503 1:217217438-217217460 CCTTTCATGGAAAAAATTGGAGG + Intergenic
923638309 1:235723707-235723729 TCCTTTATGGAAAAACTGTTGGG - Intronic
923869129 1:237971889-237971911 CCTTTTATAGAAAAAAATTGGGG + Intergenic
1064465601 10:15577326-15577348 CCTTTCATGTATAAAATGAAGGG - Intronic
1065834890 10:29647900-29647922 CTTTTTAAGTAAAAAATGTAGGG - Intronic
1066131892 10:32402652-32402674 CATTTTATTGAAAAAGTGTGTGG - Intergenic
1066463973 10:35637708-35637730 CCTTTAATGGAAGAACTTTAAGG + Intergenic
1068680432 10:59813689-59813711 CATTTTATGTAATAAATGCAGGG - Intronic
1069092642 10:64220153-64220175 CCTTTTATGGAAGGAATGTCAGG + Intergenic
1073478542 10:103770956-103770978 CTTCTTATGGAAAAGATTTAAGG - Intronic
1074031762 10:109696272-109696294 CTTTTTTTAGAAAAACTGTAAGG + Intergenic
1075224766 10:120618343-120618365 CTTTTTAAGGAAACACTGTAGGG + Intergenic
1076031427 10:127162533-127162555 CCTACCATGGAAAAAAAGTAAGG - Intronic
1078279392 11:9884885-9884907 CATTTCATGGAAACAATCTAAGG + Intronic
1079472505 11:20791477-20791499 TCTTATATGGAAAAATTCTAAGG - Intronic
1080312365 11:30909663-30909685 CATTTTTTGGCAAGAATGTAAGG - Intronic
1081974153 11:47220855-47220877 CCTATTATAAAAACAATGTATGG + Intronic
1082037716 11:47658708-47658730 CCTTTTAGGGATAAAAAGTGGGG + Intergenic
1083065603 11:59920958-59920980 GCTTTCTTGGAGAAAATGTATGG + Intergenic
1085857601 11:80193113-80193135 CCTTACATGACAAAAATGTAAGG + Intergenic
1086398075 11:86436927-86436949 CCTTTTTTGGTATAAATTTAAGG + Intergenic
1086535665 11:87842079-87842101 ACTTTGATGGCAAAAATGTCAGG - Intergenic
1086574690 11:88326100-88326122 CCTTTTATTAAAAAACTGAACGG + Intronic
1087665837 11:101046598-101046620 CCTTTTATAAAATAAATGCAAGG - Intronic
1087956054 11:104289350-104289372 CCTATTATGGAAGAAATAAAAGG + Intergenic
1088135252 11:106549224-106549246 CCTTTTATGGCTAAATAGTAAGG - Intergenic
1091990594 12:4952588-4952610 ACTTTCATGGAAAAGATTTAAGG + Intergenic
1092693284 12:11140353-11140375 GCTGTTATTGAAAAAATGAATGG + Intronic
1094107228 12:26826980-26827002 CCTAGTATAGAAAAAATGGAAGG + Intronic
1094154566 12:27325731-27325753 ATTTTTATGAAAAAAATGTGAGG + Exonic
1096330902 12:50711860-50711882 CCTTTTATTAAAACAATTTAAGG - Intronic
1096940638 12:55340954-55340976 GATTTTCTGGAAGAAATGTATGG + Intergenic
1096942547 12:55363296-55363318 ACTTTTATGGTAAATATGAATGG - Intergenic
1097476281 12:60059455-60059477 ATTATTATGGAAAAAATGTAAGG - Intergenic
1097620386 12:61932245-61932267 CCATTTATGGCAAAAAGATAAGG + Intronic
1098468278 12:70814081-70814103 GCTTTTATAGAAAAAATTTATGG - Intronic
1098636212 12:72786902-72786924 CTTTTTAGGGAAACAAAGTATGG + Intergenic
1098959668 12:76726749-76726771 TCTTTTTTGGAAAAAATGACTGG + Intergenic
1099036604 12:77594974-77594996 GCCATTATGGAAAAAAAGTATGG + Intergenic
1099080453 12:78172716-78172738 TCCTTTATGGAACTAATGTAAGG + Intronic
1099767625 12:87008670-87008692 ACTTGTATGAAAAAAATGAACGG + Intergenic
1100048539 12:90414357-90414379 CTTTTTAAGGAAAAAAAGTGGGG + Intergenic
1100241954 12:92718573-92718595 CCTTTTAGGGAAAAATTGTATGG + Intergenic
1101367796 12:104091479-104091501 CCTTTTAAGGAAAAAGAGAATGG - Intronic
1101896726 12:108762464-108762486 CCATTTCTGGAAGAAATATATGG + Intergenic
1103434605 12:120915151-120915173 GCTTTTGTGGAGAAAATGGAGGG - Intergenic
1103545338 12:121697036-121697058 TCTTTTGTGCATAAAATGTACGG - Intergenic
1104618601 12:130292323-130292345 CATTTTATGAAAAAAAAGTCAGG + Intergenic
1106274724 13:28193248-28193270 CTATTTATTGAAAAAATTTAGGG + Intronic
1106630199 13:31463673-31463695 CCGTAGAGGGAAAAAATGTATGG + Intergenic
1107692057 13:42963080-42963102 CCTTTGAAGGATAAAATGGAAGG + Intronic
1108117129 13:47141006-47141028 CATTTTATGTTAAAAATTTAGGG + Intergenic
1108385102 13:49892523-49892545 CCTTCTTTGGATAAAATGGATGG + Intergenic
1108590519 13:51908673-51908695 CCTTCTTTGGATAAAATGGATGG - Intergenic
1108604096 13:52019982-52020004 CCTTTTATGGCATAAATTAATGG + Intronic
1109505653 13:63299456-63299478 TCCTTTATGGAAGAAATGAATGG + Intergenic
1109901798 13:68782406-68782428 AATTTTTTGTAAAAAATGTAAGG + Intergenic
1110384143 13:74889054-74889076 ACTTTTTTGGCAAAAAGGTAAGG + Intergenic
1110414626 13:75238394-75238416 CCTTCTTTGGATAAAATGGATGG - Intergenic
1110762154 13:79242555-79242577 CTTTTTATAAAAAAAATATAGGG - Intergenic
1111138477 13:84083592-84083614 ACTTTTATGGAAATAAAGGAAGG - Intergenic
1111169492 13:84507318-84507340 TCTTTTGTGAAAAAAATGGATGG - Intergenic
1111363983 13:87216602-87216624 TATTTTATTGAAAAAATGTCTGG + Intergenic
1113498297 13:110751552-110751574 CCCTTTATGTGAAATATGTACGG - Intergenic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1115004593 14:28467434-28467456 CTTTCTATGGCAGAAATGTATGG + Intergenic
1115261044 14:31454697-31454719 TCTATTATGGAATAAATGAAAGG - Intronic
1115774676 14:36702327-36702349 TCTTTTTTGGAAACAATGTTTGG - Intronic
1116096138 14:40371453-40371475 CATTTTATGAAAAAAATTTTGGG - Intergenic
1116444509 14:44992930-44992952 CTTTTTATGAAAAATATGCAGGG + Intronic
1116713772 14:48402228-48402250 GCTTTTATGGAAAAATGGTAGGG - Intergenic
1116761160 14:49016663-49016685 CCTTTGAAGGCAAAAATGAAAGG + Intergenic
1117033430 14:51700421-51700443 CATTTTATGAAAAACAAGTATGG - Intronic
1117632252 14:57706206-57706228 CCATCTATGTAAAAAATTTAAGG + Intronic
1117673914 14:58136984-58137006 CTTTTTTTGTAAGAAATGTAAGG + Intronic
1117911156 14:60639254-60639276 ACTTTTATGGAAGAACTGAAAGG - Intergenic
1118261970 14:64256119-64256141 TCTTTTATGGAAAAAGTGCTAGG - Intronic
1118483764 14:66194919-66194941 CCTCTTTTGGAAAAAATATCTGG - Intergenic
1118521791 14:66594143-66594165 CCATTTATGAAAGAAATTTAGGG + Intronic
1119542144 14:75446782-75446804 ACTTTAATGGACAAATTGTATGG + Intronic
1119975282 14:79017939-79017961 CCTTTTATAGTGAAAATGTTTGG + Intronic
1120963136 14:90143079-90143101 CCTGGTAAGGAAAAAAGGTAGGG + Intronic
1121375015 14:93400574-93400596 CCTTTTAAGGCAGAAATGTAGGG + Intronic
1123186287 14:106520377-106520399 CATTTTAGGGAAAGAATGGAAGG + Intergenic
1124530975 15:30505987-30506009 TCTTTTCTGGAAAAAAAATATGG - Intergenic
1124767680 15:32501708-32501730 TCTTTTCTGGAAAAAAAATATGG + Intergenic
1125073258 15:35581785-35581807 CCTTTTATTAATATAATGTAAGG + Intergenic
1125456529 15:39865689-39865711 CCTTTTTTGGTATAAATTTATGG - Intronic
1125572321 15:40730206-40730228 CCTGTTATTTAAAAAATGTTTGG + Intronic
1126054553 15:44717688-44717710 CACTTTATGCACAAAATGTAGGG + Exonic
1126378669 15:48023055-48023077 AATTTTATGGAATAAATATATGG + Intergenic
1126616430 15:50585885-50585907 CCTTTTGTGTAAAAAATGAGAGG + Intronic
1126634651 15:50768584-50768606 CCTTTTATAGAATAGCTGTATGG + Intergenic
1127879494 15:63143896-63143918 CCTTTCATGAAAAAAAGGTATGG - Intronic
1128702704 15:69815808-69815830 CCATTTCTGGAAAATTTGTAGGG + Intergenic
1128951802 15:71892671-71892693 CCGTTTACAGAAAAAATGTAAGG + Intronic
1130636448 15:85625516-85625538 CCTTTAATGAAAAAAATGTCTGG + Intronic
1130696781 15:86139349-86139371 CCTATTATGAAAAAACTCTAAGG - Intergenic
1133114736 16:3570993-3571015 CCATATATGTAAAAAATGTGTGG + Intronic
1135844001 16:25901820-25901842 TCTGTAATGGAAAAAATGAAAGG - Intronic
1137721673 16:50631089-50631111 CCTTTTATGGAACACATCTTGGG + Intronic
1138254569 16:55543955-55543977 CCTTTTTAAGATAAAATGTATGG - Intronic
1139189985 16:64851582-64851604 CCTTTTATTAAAAAATTTTAGGG - Intergenic
1141655292 16:85412826-85412848 CTTTATATGGCAAAAAGGTAAGG - Intergenic
1142556939 17:785347-785369 AGTTTTATGGAAAGAATTTATGG - Intronic
1144431229 17:15193639-15193661 CATTTTATAGAAAAAATCTCAGG - Intergenic
1146776143 17:35618958-35618980 CCTTTGCTGGAAATAATGTTTGG + Intronic
1147348495 17:39821709-39821731 CCTCTAATGGAAAAAATATGTGG + Intronic
1148177560 17:45580680-45580702 CCTTTTATGGAAAAAATGTAAGG - Intergenic
1149360281 17:55888123-55888145 TCTTTTGTGGAAAATCTGTATGG + Intergenic
1149543538 17:57486530-57486552 CGTTTTATGCAAATAATATATGG + Intronic
1150587718 17:66533606-66533628 CCTTAGATGGGAAAAATGAATGG - Intronic
1150747772 17:67829948-67829970 CCTTTTATGGAAAAAATGTAAGG + Intronic
1154217877 18:12428847-12428869 CCTTTTATGTGAAAAATTTGGGG + Intronic
1155081619 18:22415947-22415969 CCTTCTTTGGATAAAATGGATGG - Exonic
1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG + Intronic
1155821967 18:30389102-30389124 TGTTTTATGGAAGAAATGAAGGG + Intergenic
1156007211 18:32456593-32456615 AATCTTAGGGAAAAAATGTAGGG - Intronic
1156119392 18:33823493-33823515 CCTTGTAAGGAAAAAATATCAGG - Intergenic
1156645512 18:39156660-39156682 CATTTTTTAGAAAAAATATAGGG + Intergenic
1156900091 18:42290401-42290423 CCTTTTGTGCAAAAACTCTAGGG - Intergenic
1157812828 18:50709870-50709892 GTTAATATGGAAAAAATGTAAGG - Intronic
1159640993 18:70862711-70862733 CCTTTTAAGAAAGAAATGCAAGG + Intergenic
1159982387 18:74799969-74799991 GTATTTTTGGAAAAAATGTAAGG - Intronic
1162663128 19:12186106-12186128 TGTTTTAGGGAAAAAATGGAAGG + Exonic
1162983508 19:14254377-14254399 CCTCCTGTGGAAAAAATGAATGG - Intergenic
1163962033 19:20705669-20705691 ACTCTTATGGATAAAATTTAAGG - Intronic
1164729621 19:30493301-30493323 CCTTTGTTAGAGAAAATGTAAGG + Intronic
1165209150 19:34218957-34218979 CCTTTTATGGAAAGAATAACAGG - Intronic
1165550271 19:36577967-36577989 CATTTTATAAAAAAAATATAAGG - Intronic
924971318 2:130083-130105 CCTTTTATCAAGAAAATGAAAGG + Intergenic
925304817 2:2840650-2840672 CCTTTTATGGTAAGACTTTAGGG - Intergenic
925585141 2:5457762-5457784 CTTTTTTTGGAAAAAATAAAAGG - Intergenic
925957776 2:8985031-8985053 CCCTCTAAGAAAAAAATGTAAGG + Intronic
926958605 2:18329984-18330006 CTTTTTATGGATGAATTGTATGG + Intronic
927130532 2:20054651-20054673 CCTTTTTTGAGAAAATTGTAAGG + Intergenic
928945104 2:36765078-36765100 CCTTATATGGAAAAAATGTGGGG + Intronic
930307225 2:49690110-49690132 CCTTTTATGGAATATGTTTATGG + Intergenic
930454312 2:51585539-51585561 TCTTTTATGTTAAAAATTTAAGG + Intergenic
930912582 2:56647387-56647409 CCTTTAATGGCATAAATCTATGG - Intergenic
932885161 2:75542760-75542782 CCCTTCATGGAGAAGATGTAGGG + Intronic
933249517 2:80013278-80013300 CCCTTTATGGAAATAATAAAAGG - Intronic
933373844 2:81452935-81452957 CCTTTGATGGGAATATTGTATGG - Intergenic
935194579 2:100804887-100804909 CATTTTATGAAAAAAATAAAAGG + Intergenic
938186784 2:129239148-129239170 CATTTTGTGCATAAAATGTAAGG + Intergenic
939378025 2:141396115-141396137 CTTATTATGGAACAAATGTAAGG - Intronic
939513557 2:143137980-143138002 ACATTAAAGGAAAAAATGTATGG + Intronic
939740990 2:145906073-145906095 TCCTTTATGTAAATAATGTATGG + Intergenic
940289406 2:152063848-152063870 ACTTTTCTGGAAAAATTGTGAGG - Intronic
940528818 2:154852526-154852548 GCTTTTAGGGAGAAAATATAAGG + Intronic
940804438 2:158170312-158170334 CCATTTTTGTAAAAGATGTAAGG - Intergenic
940975520 2:159939047-159939069 GCTTTTTTGGCATAAATGTAAGG + Exonic
941615513 2:167714110-167714132 CCTTGTTTGGATAAAATGGATGG - Intergenic
942499458 2:176573596-176573618 TCTATTAATGAAAAAATGTAAGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
944366732 2:198929577-198929599 ACATTTGTGGAATAAATGTATGG - Intergenic
944968474 2:204963249-204963271 TCTTATGTGGATAAAATGTATGG + Intronic
945313972 2:208350545-208350567 CTTTTTTTGGAAAGTATGTAAGG + Intronic
947202255 2:227624582-227624604 CCCTTTAAGGCAAAAATTTATGG - Intronic
947628247 2:231634767-231634789 CCTTTTATGGAAAAGCTGCCAGG - Intergenic
1169099696 20:2936184-2936206 GCCATTATGGAAAACATGTATGG - Intronic
1169168815 20:3447450-3447472 GCATTTAGGGAACAAATGTAGGG + Intergenic
1169306522 20:4495659-4495681 ACTTTTAGGGAAAGAATTTAAGG - Intergenic
1169398742 20:5260834-5260856 CCTTCTATGGCAAAAATGAGTGG + Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170005083 20:11659091-11659113 AATTTTATGGAAATAATGAAAGG + Intergenic
1170019098 20:11815985-11816007 CATTTTCAGGAAAAAATTTAAGG - Intergenic
1170421995 20:16202339-16202361 ATTTTTATGGAAAAAAAGGATGG + Intergenic
1171440320 20:25155749-25155771 ACTTTTAAGAGAAAAATGTAGGG - Intergenic
1172760575 20:37318441-37318463 CCTTTAAGGGAAAGAATTTAAGG - Intergenic
1174599821 20:51715243-51715265 CCTTTGATTGTAAAGATGTATGG - Intronic
1174652787 20:52142528-52142550 CCTTTTTTGGTATAAATTTAAGG - Intronic
1174899865 20:54487980-54488002 TCTTTTATTGAATGAATGTATGG - Intronic
1176691317 21:9913976-9913998 CATTTTATGGACACAGTGTAGGG - Intergenic
1177675933 21:24298624-24298646 GCATTTATGAATAAAATGTAAGG + Intergenic
1177782265 21:25634016-25634038 GCTCTTATGGATAGAATGTAAGG - Intergenic
1179559377 21:42203393-42203415 CCTTTCAGGGAAAAAATATTAGG - Intronic
1181561104 22:23701089-23701111 CCTTTTTTGGAAAATATGGTAGG - Intergenic
949360375 3:3225560-3225582 CCTTTTACTGAAAACATGAAGGG + Intergenic
950227729 3:11249633-11249655 CCTTTAGTGAAACAAATGTATGG + Intronic
951507566 3:23465444-23465466 CCTTTTATGGCTAAAAGTTACGG - Intronic
951578881 3:24141210-24141232 CCATCTATGGAAAGAATCTATGG - Intronic
952347934 3:32505641-32505663 CAATTTATGAAGAAAATGTAAGG - Intergenic
952453998 3:33455958-33455980 CCTTTTATTTAAAAAATGTATGG - Intergenic
953370779 3:42386514-42386536 CCTTTTATGGAAAAAAAGGGGGG - Intergenic
954962041 3:54575164-54575186 CCTTTGAATGAAAACATGTAGGG - Intronic
955803197 3:62706981-62707003 CCTTTTTTTGTATAAATGTAAGG - Intronic
957262040 3:77914360-77914382 GGTTTTATGGAAAAAATATCTGG + Intergenic
957341950 3:78911322-78911344 GCTTTTATGGAAGTAATGTATGG + Intronic
957552398 3:81723505-81723527 CTTTTTAAGAAAAAAATCTAAGG - Intronic
959221338 3:103524564-103524586 CTTTTTATGAAGAAAATTTAGGG - Intergenic
960176729 3:114526062-114526084 AGTTTGATGGAAAAAATGCAGGG - Intronic
960936731 3:122908983-122909005 CCCTTTTTGGAAAAGATGTTGGG - Intergenic
963015934 3:140823893-140823915 ACTTTTATTGAAAAAATTTTGGG - Intergenic
963236014 3:142957127-142957149 AATTTTATGGAAACAAAGTAAGG + Intronic
964303945 3:155320526-155320548 GCTATTAAGGAAAAATTGTATGG - Intergenic
965148195 3:164933768-164933790 CAGTTTATGGAAAAGATGAAAGG + Intergenic
965554359 3:170004314-170004336 CATTTTGTGGAAAATATGAAGGG + Intergenic
966493438 3:180553427-180553449 AGATTTATGGAAAGAATGTAAGG + Intergenic
966612847 3:181885315-181885337 CCTCTTATAATAAAAATGTAAGG + Intergenic
966991695 3:185238330-185238352 ACCTTTATGGAAAAACAGTATGG - Intronic
967273639 3:187751941-187751963 CATATTATGGAAAGAGTGTAAGG + Intergenic
967532283 3:190562551-190562573 CCTCTCATGGGCAAAATGTAGGG - Intronic
967989917 3:195123192-195123214 CCATTCAGGAAAAAAATGTAGGG - Intronic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
969967661 4:11013869-11013891 CCTTATTTGGAAAAAGTGTGAGG + Intergenic
971851609 4:31992365-31992387 TTTTTTATAGCAAAAATGTATGG + Intergenic
972553330 4:40154849-40154871 CATTTTATGGAAAGAAAGTTGGG + Exonic
972930142 4:44062523-44062545 CCATTTATGGCAAAAAAGGAGGG - Intergenic
973680196 4:53309455-53309477 ACTTTTATGGAAAAAATCTCTGG - Intronic
974693353 4:65331456-65331478 CCTTAGATTGAAAGAATGTAAGG + Intronic
974706864 4:65530172-65530194 ACTTTTATAGAAAAAATATATGG + Intronic
974835704 4:67247691-67247713 CCTTTTATGAAATAAATTTTGGG - Intergenic
976385489 4:84452930-84452952 CCATTTGTTGAAACAATGTATGG - Intergenic
976886681 4:89993482-89993504 CTTTTAATGGAAAAAATGGAAGG + Intergenic
978389963 4:108215189-108215211 CTGTTTATGGAATAAATGAATGG - Intergenic
978729506 4:112008912-112008934 CACTTTATGGAAGAAATGTTTGG + Intergenic
978843757 4:113247587-113247609 CCTTTTCTAAAAAACATGTAAGG + Intronic
979574525 4:122272384-122272406 ACTCTTAAGGAAAAAATGAAAGG + Exonic
979582842 4:122379963-122379985 CCATTTATGGAAATAATGGGGGG + Intronic
979838287 4:125402701-125402723 GCTATGATGGAAAAGATGTATGG + Intronic
980363905 4:131774163-131774185 CATTTTATGGACACAGTGTAGGG - Intergenic
981186354 4:141808353-141808375 ACTCTTATGGAAATACTGTATGG + Intergenic
981240381 4:142468893-142468915 CCTATTAGGGAACAAATGTATGG - Intronic
981303155 4:143213726-143213748 ACTTTAATAGAAAAAATGTTTGG + Exonic
981410838 4:144428812-144428834 TCTTTTATTTTAAAAATGTAAGG - Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
981930045 4:150179987-150180009 ACTTTTATGGAGTAAATGAATGG - Intronic
986839517 5:11680117-11680139 CATTTTAAGGAAAAACTGTGAGG + Intronic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
987705365 5:21457161-21457183 CCTTTTATAATAAAAATGAATGG - Intergenic
987785222 5:22490769-22490791 CTTTTTATAGTGAAAATGTAGGG + Intronic
987922384 5:24299851-24299873 CCATTAAAGTAAAAAATGTAAGG + Intergenic
988364415 5:30277494-30277516 CCTTCTAGGTAAAAAATGTGTGG + Intergenic
988730310 5:33966153-33966175 TATTTTATGGAAAAAATATAAGG + Intronic
989024988 5:37057102-37057124 CCTTTTTTAGAAAAAATACAGGG - Intronic
989256399 5:39370155-39370177 CCTTTTATGTGAGAAATTTAAGG + Intronic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
989636772 5:43544389-43544411 CCAATAATGGGAAAAATGTAAGG - Intronic
989702097 5:44280887-44280909 CCTATTATGGAAGAAACTTAGGG + Intergenic
990157704 5:52898056-52898078 CCTTTTCTGTAAAACAGGTATGG + Intronic
990295499 5:54397741-54397763 TCTTTTATGGAAAGAAAGAAGGG - Intergenic
990422736 5:55652858-55652880 TCTTTTCTGGAAAAAATAGAGGG + Intronic
990439375 5:55829441-55829463 CCTTTTATAGAAAAAAGATTTGG + Intergenic
990723520 5:58726632-58726654 CCATTTATGAAAAAAGTTTATGG + Intronic
992568037 5:78022118-78022140 CCACATATGGAAAAAATATAAGG - Intronic
993354206 5:86885530-86885552 CCTTCTGTGGATGAAATGTATGG + Intergenic
993640442 5:90398007-90398029 CATCTTTTGGAAAAAATGAAAGG - Intronic
993970749 5:94417059-94417081 CTTTATACTGAAAAAATGTAAGG + Intronic
994147336 5:96410073-96410095 CCTTTAATTTAAAAAATGTAAGG - Intronic
994295914 5:98088108-98088130 CCTTCTATTTAAAAACTGTAAGG - Intergenic
994467940 5:100162578-100162600 GTTTTTATGGTAAAAATGTTTGG - Intergenic
994791312 5:104229847-104229869 CATATTATGGAAGAAATTTAGGG - Intergenic
995304221 5:110624984-110625006 TCTTTTTTGGAAAATATGTGAGG + Intronic
996561144 5:124830866-124830888 CCTTTTTGGGGAAAAATGTGAGG + Intergenic
996567635 5:124897001-124897023 CCTTTTATAGAAAAGGTGAAGGG + Intergenic
996760497 5:126981930-126981952 GCTTTTTTGGAAAATATCTAGGG + Intronic
996857596 5:128027137-128027159 CCATATATGGAAAATATGTTGGG + Intergenic
997204373 5:132035295-132035317 CCCTTTACAGAAAAAATGTTTGG + Intergenic
997286853 5:132686127-132686149 TCTTTTATGGAAACATTGTTGGG + Intergenic
998346260 5:141466863-141466885 CATATTATGAAAAAAATGTGTGG - Intronic
999072574 5:148761863-148761885 CCTTTTATGTAAAAAAAATGTGG - Intergenic
999562707 5:152821859-152821881 CCTTTTATTTTAAAAATTTAGGG - Intergenic
1001216518 5:169860960-169860982 CCTTTTAAGGAAAAAAATTAAGG + Intronic
1003455032 6:6274321-6274343 CCTCTTTTGGAGTAAATGTAAGG + Intronic
1004226707 6:13791554-13791576 TATTTTATGGATAAAATGGAAGG - Intronic
1004649692 6:17597771-17597793 CTTTTTAAGGAAAAAAATTATGG + Intergenic
1006139472 6:31919648-31919670 CCATTTATGCAAAAAAAGGAGGG - Intronic
1006332094 6:33398943-33398965 CCATTTATGTAAAAAAGGTGGGG - Intronic
1008334250 6:50281341-50281363 CCTTTTTTGGAAAATAAGAAAGG + Intergenic
1008346369 6:50432412-50432434 CCATTCATTGAAAAAATGTGGGG + Intergenic
1008401076 6:51063890-51063912 CATTTTGTGGGAAAAATGGAGGG - Intergenic
1009022936 6:57963746-57963768 CCTTTTATAATAAAAATGAATGG + Intergenic
1009614490 6:65987668-65987690 CCTTTTGTGAAATAAATTTATGG - Intergenic
1010116220 6:72316164-72316186 CCTTTTTTGGGAAAAAGGTTAGG - Intronic
1010711922 6:79185047-79185069 CCTTTTGTGGAAAAAAATTGTGG + Intergenic
1010917696 6:81641294-81641316 CCTTTTATGTAAAAAACATAGGG - Intronic
1011448010 6:87463593-87463615 TCTTTTATGTTAAAAATCTAGGG + Intronic
1012786286 6:103631418-103631440 ACCCTTATGGAAAAAAAGTATGG + Intergenic
1013119178 6:107126227-107126249 CCATTTATGGGAAAAATCTTGGG + Intergenic
1013322076 6:109003348-109003370 CCTTTTAAAGAAAAAAAGTGGGG + Intronic
1015250865 6:131126273-131126295 CCTTTTATTGAAAATAGGCAGGG + Intergenic
1018698748 6:166411009-166411031 TCTTCTATGGAGAAAATGTGAGG + Intronic
1018938127 6:168287361-168287383 CCTTCTTTGGATAAAATGGATGG - Intergenic
1019201639 6:170321181-170321203 AATTTTATAGAGAAAATGTAAGG - Intronic
1019752232 7:2738517-2738539 CCTTTTATGTAAGAAATGGCGGG + Intronic
1019783173 7:2956760-2956782 TATTTCATGGAAAAAATCTATGG + Intronic
1020223988 7:6265310-6265332 CCTTTTATGAAAAAAAAGCTTGG + Intronic
1021807839 7:24374564-24374586 CATATTATGAAAAAGATGTAAGG + Intergenic
1023536409 7:41217322-41217344 CCTTTTGGGAAAAAAAGGTAAGG - Intergenic
1024389353 7:48789352-48789374 CATTTTGTGGAAAAAATGGATGG + Intergenic
1027406159 7:77863497-77863519 CCTTATATGAAATCAATGTAAGG - Intronic
1027505161 7:79007806-79007828 CCTTTTATGCAATAAATAAAAGG + Intronic
1027786800 7:82590346-82590368 ACTTTTATGTAATTAATGTAGGG - Intergenic
1027976666 7:85165801-85165823 CCTTTTATGGAGAAAATATGTGG + Intronic
1028055591 7:86238029-86238051 TCTTTTATTGCAATAATGTATGG + Intergenic
1028077047 7:86529577-86529599 CCTTTTATGGAAATTGTGAATGG + Intergenic
1028122139 7:87068217-87068239 TGTTTTCTGGACAAAATGTATGG + Intergenic
1028315485 7:89396880-89396902 CCTCTTTTTGAAAAAATGTCTGG - Intergenic
1028750919 7:94381927-94381949 CATCTTATGGGAAATATGTAGGG - Intergenic
1030133805 7:106226933-106226955 CCATTTATGAAACAAATGTAGGG + Intergenic
1030387279 7:108879543-108879565 CCATTTATCAAAGAAATGTAAGG - Intergenic
1030444669 7:109634344-109634366 TCTTTTTTTAAAAAAATGTAGGG - Intergenic
1031014300 7:116556529-116556551 CACTTTATAGAAAAAATGTGAGG - Intronic
1033164130 7:139024421-139024443 TCTTTAATGGAAACAGTGTAGGG - Intergenic
1034508428 7:151515650-151515672 CTTTTTATTGAAAAATTGAAAGG - Intronic
1035010065 7:155707480-155707502 CCATTTAAGGAAAAAATCTATGG - Intronic
1035790223 8:2297484-2297506 CCATGTCTGGAAAATATGTATGG - Intergenic
1035802582 8:2424221-2424243 CCATGTCTGGAAAATATGTATGG + Intergenic
1036035554 8:5014572-5014594 CCTATCACGCAAAAAATGTAAGG - Intergenic
1037148496 8:15604793-15604815 CCAAATATAGAAAAAATGTAGGG - Intronic
1038062158 8:23925555-23925577 CCTTATTTGAAAAAAATGAAAGG - Intergenic
1038693842 8:29787425-29787447 CCTTTTATGAAAAGAATTTCAGG + Intergenic
1039575781 8:38623028-38623050 CCTGTCATGCATAAAATGTAGGG + Intergenic
1040629971 8:49198986-49199008 TTTTTCATGGAATAAATGTAGGG - Intergenic
1040638134 8:49299687-49299709 CCTTTTAGATAAAAATTGTATGG + Intergenic
1041206898 8:55508919-55508941 CCTTTCATTGGAAAAATGGAGGG - Intronic
1041504138 8:58575505-58575527 CCTTTTATGGAAATTCTGAAAGG + Intronic
1042711144 8:71718877-71718899 CCTTTTAGGGAAGAAAAATATGG + Intergenic
1042718016 8:71795982-71796004 CCTTTCATGGAAAATCTGTGTGG - Intergenic
1042893332 8:73636927-73636949 GCTTTTAATGAATAAATGTATGG + Intronic
1043180285 8:77080268-77080290 ACTTTTATGAATAAAATGTTTGG - Intergenic
1044337390 8:91003496-91003518 CTTTTTCTAGAAATAATGTAGGG + Intronic
1044421454 8:92000462-92000484 TTTTCTATGAAAAAAATGTAGGG - Intronic
1045003187 8:97895908-97895930 CCCTTTATGGAAAGGATGCATGG + Intronic
1045966386 8:108029689-108029711 CTTTTAGTGGAAAAAATGTTTGG - Intronic
1047299439 8:123600297-123600319 CCTTTTATTGAGAAACTGTCAGG + Intergenic
1048129857 8:131683694-131683716 ACTTTTAAGGAAAAAGTGAAAGG + Intergenic
1048400489 8:134063422-134063444 CCATTTGTGGAAAAACAGTATGG + Intergenic
1049485807 8:142859757-142859779 ACCTTTATGGAAAAACAGTATGG - Intronic
1050682555 9:8130177-8130199 ACTTTTATGGAAAAAAAATGAGG - Intergenic
1052431954 9:28377804-28377826 CATTTTCTGCAATAAATGTAAGG + Intronic
1053628249 9:39900047-39900069 CATTTTATGGACACAGTGTAGGG - Intergenic
1054215638 9:62350654-62350676 CATTTTATGGACACAGTGTAGGG + Intergenic
1054364243 9:64316143-64316165 CATTTTATGGACACAGTGTAGGG - Intergenic
1054671843 9:67804696-67804718 CATTTTATGGACACAGTGTAGGG - Intergenic
1054953391 9:70879758-70879780 CCATTTATGCAAAACATGTTAGG - Intronic
1055017033 9:71629864-71629886 CCTTTTATCCAAAAAATGTGTGG + Intergenic
1058026738 9:100148360-100148382 CATTTTATGCAAAAATTTTAAGG + Intronic
1058568860 9:106318775-106318797 ATTTTTAAGGAAAAAAAGTAAGG + Intergenic
1058621806 9:106890973-106890995 TCTTTTTTGGAAAAATCGTATGG + Intronic
1058943337 9:109834374-109834396 TCCTTTATAGAAAAAAAGTAAGG - Intronic
1059703286 9:116796363-116796385 CCTTTTCTGGGAAAAATGGTGGG + Intronic
1060461493 9:123859147-123859169 CCTTTTATAAAGAAAATGTCAGG - Intronic
1187139462 X:16578474-16578496 CCTTTTAAGGAAAAAAAATGTGG + Intergenic
1187303632 X:18075277-18075299 TCTTTTATGGGGAAAATGAAAGG + Intergenic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1187742062 X:22366576-22366598 TCATTTATGTGAAAAATGTAGGG + Intergenic
1187802874 X:23083797-23083819 GCCATTATGGAAAAAAAGTATGG + Intergenic
1188537887 X:31217745-31217767 CCTTTTATTGAACATATGTGTGG - Intronic
1191744055 X:64466273-64466295 CAGTGTATGGAAACAATGTAAGG + Intergenic
1192129831 X:68539146-68539168 CCTCTTCTGAAAAAAATGGAGGG - Intergenic
1193729475 X:85085614-85085636 TCTTTTATGCAGAAAAGGTATGG + Intronic
1195458639 X:105098835-105098857 CATGTTATGGCAAAAATCTATGG + Intronic
1198781711 X:140244844-140244866 CCTATAAAGGAAAAAATGAAAGG - Intergenic
1201890786 Y:18941632-18941654 TATTTTATGAAAAAAATGTTGGG - Intergenic