ID: 1150753686

View in Genome Browser
Species Human (GRCh38)
Location 17:67890465-67890487
Sequence TAAAATCCAGAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 1, 1: 0, 2: 1, 3: 57, 4: 833}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150753686_1150753690 -9 Left 1150753686 17:67890465-67890487 CCCTTCTCCATCTCTGGATTTTA 0: 1
1: 0
2: 1
3: 57
4: 833
Right 1150753690 17:67890479-67890501 TGGATTTTAAAAACTGGAAAAGG 0: 1
1: 0
2: 5
3: 73
4: 804
1150753686_1150753691 2 Left 1150753686 17:67890465-67890487 CCCTTCTCCATCTCTGGATTTTA 0: 1
1: 0
2: 1
3: 57
4: 833
Right 1150753691 17:67890490-67890512 AACTGGAAAAGGATGCTGAGAGG 0: 1
1: 0
2: 2
3: 44
4: 293
1150753686_1150753692 26 Left 1150753686 17:67890465-67890487 CCCTTCTCCATCTCTGGATTTTA 0: 1
1: 0
2: 1
3: 57
4: 833
Right 1150753692 17:67890514-67890536 TTGAGCCAAAGAGCCAGTCCTGG 0: 1
1: 0
2: 0
3: 22
4: 224
1150753686_1150753693 27 Left 1150753686 17:67890465-67890487 CCCTTCTCCATCTCTGGATTTTA 0: 1
1: 0
2: 1
3: 57
4: 833
Right 1150753693 17:67890515-67890537 TGAGCCAAAGAGCCAGTCCTGGG 0: 1
1: 0
2: 0
3: 33
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150753686 Original CRISPR TAAAATCCAGAGATGGAGAA GGG (reversed) Intronic
900348406 1:2222950-2222972 TAAAATACAGAAAGGGAGGAAGG - Intergenic
900845596 1:5097858-5097880 TAATCTCCAGTGATAGAGAAGGG - Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902309355 1:15568987-15569009 TAAAATCGACAGAGGCAGAAAGG - Exonic
902461899 1:16583875-16583897 CAAAATTTAGAGATGAAGAAAGG + Intronic
902827946 1:18989905-18989927 TATCATCCAGTGGTGGAGAATGG + Intergenic
903401294 1:23052146-23052168 AAAAATCCAGATTTGGGGAAGGG + Intronic
903450276 1:23449095-23449117 TGAGATCCAGAGAAGGAAAATGG + Intronic
904275664 1:29382632-29382654 TAAAAGTGAGAGATGGAGATGGG - Intergenic
904352659 1:29918976-29918998 GAAGAAACAGAGATGGAGAAAGG - Intergenic
904375661 1:30080657-30080679 TAGAAACCAGAGATGGAGCTAGG - Intergenic
904710058 1:32423516-32423538 GAGAATCCAGAGGTGGGGAAGGG + Intergenic
905065527 1:35178126-35178148 AAAAATCCAGAGATAAAGATTGG + Intronic
906013982 1:42556582-42556604 TAAAAACCACATATGGAGAATGG + Intronic
906192697 1:43908277-43908299 TAGAATACAGACATAGAGAAGGG - Intronic
906253627 1:44330855-44330877 TGAGATACAGAGATGCAGAAAGG + Intronic
906283068 1:44567014-44567036 GAAAAGCTAGAGATGGTGAAGGG + Intronic
906594157 1:47059004-47059026 TAAAAGCCAGTGAAGGATAAAGG + Intergenic
907003566 1:50887637-50887659 TAAAAACAAGAAATGGGGAAAGG - Intronic
907005202 1:50906138-50906160 TAAAAACAAGAAATGGGGAAAGG - Intronic
907133616 1:52118952-52118974 TAAAGTTCAGAGAAGGGGAAAGG - Intergenic
907379597 1:54075259-54075281 TAAAATCAAGGGATGTACAAAGG + Intronic
907629212 1:56062890-56062912 TAAAAGCCAGTGACGGAGACTGG + Intergenic
908100065 1:60781698-60781720 CAAAAACAAGAAATGGAGAAAGG + Intergenic
908349689 1:63272357-63272379 TATTATTCAGAGACGGAGAATGG + Intergenic
908457977 1:64322516-64322538 AAAAGACCAGAGATGGAGAGGGG + Intergenic
908558764 1:65284298-65284320 AGAAAGGCAGAGATGGAGAAAGG - Intronic
908681518 1:66667026-66667048 AAAAATCCAGACAAGGAAAAGGG + Intronic
908819929 1:68075305-68075327 TAAAAACAAGCAATGGAGAAGGG - Intergenic
908849892 1:68365066-68365088 TCACATCCAGAGAAGGAGAGAGG - Intergenic
908879386 1:68713514-68713536 CAAAAACAAGAAATGGAGAAAGG + Intergenic
909260852 1:73487558-73487580 TAAAAACAAGAAATGGGGAAAGG - Intergenic
909441613 1:75702390-75702412 TAAAAACAAGAAATGGGGAAAGG + Intergenic
909658851 1:78060447-78060469 TAAAATCAAGAGATGAAAGAGGG - Intronic
909807481 1:79889819-79889841 GAAAAACAAGAAATGGAGAAAGG - Intergenic
909874947 1:80790133-80790155 TAAAAACAAGCAATGGAGAAAGG + Intergenic
909932102 1:81507984-81508006 TAAAGTCAAGAGAAGGAGATTGG - Intronic
910000370 1:82333892-82333914 AACATTCCAGAGGTGGAGAAAGG - Intergenic
910335162 1:86120023-86120045 CAAAAACAAGAAATGGAGAAAGG + Intronic
910628148 1:89330317-89330339 TAAAAACAAGAAATGGGGAAAGG + Intergenic
911068491 1:93813086-93813108 TGAAATACAGAGAAGGAGAAAGG - Intronic
911724741 1:101231443-101231465 TAAAAACAAGAAAGGGAGAAAGG + Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
911886444 1:103306224-103306246 TTCAATCCAGATTTGGAGAATGG - Intergenic
911922906 1:103789847-103789869 TATAGTCTAGAGAGGGAGAAAGG - Intergenic
912001141 1:104836323-104836345 CAAAAACAAGAAATGGAGAAAGG + Intergenic
912114667 1:106390567-106390589 CAAAATCCAGTGAAGGAGACAGG + Intergenic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913310246 1:117482999-117483021 CAAAAACAAGAAATGGAGAAAGG - Intronic
914412366 1:147443163-147443185 CAAAAACAAGAAATGGAGAAAGG + Intergenic
914412967 1:147449329-147449351 TAAAATAAAGAGAGAGAGAAAGG - Intergenic
915721995 1:157992756-157992778 TAAAACCCAGAACTGGAGAATGG - Intergenic
915990284 1:160508390-160508412 TAAAAACAAGAAATGGAGAAAGG + Intronic
916132591 1:161624304-161624326 AAAAATCGAGAGTTGGATAAAGG + Exonic
916511584 1:165476534-165476556 TAAAAGCCAGAGATGAAGAGGGG - Intergenic
917111359 1:171551721-171551743 CAAAAACAAGAAATGGAGAAAGG - Intronic
917407978 1:174729208-174729230 CAAAATTCAGCAATGGAGAAAGG + Intronic
917576025 1:176322758-176322780 TATAAGGCAGAGATAGAGAATGG + Intergenic
917696957 1:177534984-177535006 TAATCTCCAGTGATGGAGACAGG - Intergenic
917827254 1:178836679-178836701 TAAAAGCCAGAAATGTAGAAGGG - Intronic
918080066 1:181200472-181200494 TAAAAACAAGAAATGGGGAAAGG + Intergenic
918170992 1:181997306-181997328 TATAATCAAGAGATCAAGAATGG - Intergenic
918300551 1:183199852-183199874 TAAAAGCCAGAGGTGGGAAAGGG + Intronic
918477349 1:184939448-184939470 TGAGACCCAGAGAAGGAGAAAGG - Intronic
919065102 1:192684212-192684234 CAAAACCAAGAAATGGAGAAAGG - Intergenic
919293916 1:195669684-195669706 TAAAAACAAGCAATGGAGAAGGG - Intergenic
919377704 1:196815321-196815343 GAAAAACAAGAAATGGAGAAAGG - Intergenic
919387219 1:196937219-196937241 GAAAAACAAGAAATGGAGAAAGG - Intronic
919417816 1:197333147-197333169 TAAAAGGCAGAGAGGTAGAAGGG + Intronic
919563703 1:199157416-199157438 TCAAATCCTGAAAAGGAGAAGGG + Intergenic
919864787 1:201772654-201772676 TATAACCCAAGGATGGAGAAAGG - Intronic
920414451 1:205789432-205789454 CAAATTCCAGAGATGAGGAAGGG + Exonic
920754701 1:208717975-208717997 TCAAAACCAGACATGGACAAAGG - Intergenic
920910732 1:210213897-210213919 AAAAAGACAGAGATGGAAAATGG + Intergenic
921563632 1:216688955-216688977 TAAAATACAGAGATGCATATGGG + Intronic
921717085 1:218428595-218428617 CAAAAACAAGAAATGGAGAAAGG - Intronic
922108905 1:222538607-222538629 TAAAATAAAAAGAGGGAGAAGGG + Intronic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
922658075 1:227403008-227403030 TAAAGTAAAGAGATGGAAAAAGG + Intergenic
922823890 1:228503662-228503684 TAAAATCCAGAGAAAAGGAAGGG - Intergenic
923185766 1:231571684-231571706 TAAATATCAGAGATGGAGATAGG + Intronic
924262869 1:242250093-242250115 TAAAATCAGGAGATTTAGAAGGG - Intronic
1063160648 10:3415853-3415875 AAAAGTCAAGAGAAGGAGAAGGG - Intergenic
1063305620 10:4897056-4897078 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1063340325 10:5257024-5257046 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1064522474 10:16217526-16217548 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1064584019 10:16821834-16821856 TAAAAGCCAGTGTTGGAGATCGG + Intergenic
1064670003 10:17703504-17703526 TAAAAACCATGCATGGAGAAAGG + Intronic
1064754353 10:18560961-18560983 TGAAATGCAGTGATGGAGAATGG + Intronic
1064755264 10:18567392-18567414 TGAAATGCAATGATGGAGAATGG - Intronic
1064921753 10:20526972-20526994 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1065157369 10:22884329-22884351 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1065157936 10:22889829-22889851 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1066721916 10:38348364-38348386 TAAAATCAGGAGATTTAGAAGGG + Intergenic
1068218711 10:54015632-54015654 TAAAAACAAGCAATGGAGAATGG + Intronic
1068338772 10:55673572-55673594 GAAAAGCAAGAAATGGAGAAAGG - Intergenic
1068484805 10:57644220-57644242 TAGAAACCAGAGATTGAGAGGGG + Intergenic
1068500288 10:57834927-57834949 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1069031841 10:63604711-63604733 TAAAATCTAGGGAAGCAGAATGG + Intronic
1069050642 10:63788900-63788922 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1069398787 10:68019611-68019633 TAGACTCCAGAGTTGCAGAATGG - Intronic
1069927501 10:71860997-71861019 TGAAATTTAGAGAAGGAGAAAGG - Intergenic
1070349745 10:75580800-75580822 CAAAATCAAGAAATGGGGAAAGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1070623978 10:78035859-78035881 TAAAATGCACAGGTGGAGTACGG + Intronic
1071344687 10:84681848-84681870 CAAAGTCCAGAGACAGAGAAGGG - Intergenic
1071900359 10:90114335-90114357 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072053812 10:91733056-91733078 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072333046 10:94372095-94372117 TAACATCCAGGGAAGAAGAAAGG + Intergenic
1072354751 10:94596935-94596957 TAAAATCTAGAGATTATGAAAGG + Exonic
1072393711 10:95016534-95016556 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1072410680 10:95199232-95199254 CAAAAACAAGAAATGGAGAAAGG + Intronic
1073630515 10:105143803-105143825 TAAAATCTACAGCGGGAGAAGGG - Intronic
1073713237 10:106070065-106070087 AAAAATCAAGCAATGGAGAAAGG - Intergenic
1073728341 10:106260939-106260961 TAAAATAAAGAGATGGATAAAGG + Intergenic
1073855995 10:107673966-107673988 CAAGATCCAGAGTAGGAGAATGG + Intergenic
1073931790 10:108584946-108584968 TAAAACACAGAGATTGACAAAGG - Intergenic
1075509562 10:123060086-123060108 TGAAATAAAGAGATGGAAAAAGG + Intergenic
1076254233 10:129008200-129008222 CAAAAACCAGCAATGGAGAAAGG - Intergenic
1077731333 11:4733645-4733667 TAAAATCCAGGGAAAGAGGAAGG - Intronic
1078032780 11:7770084-7770106 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1079590717 11:22179257-22179279 TGAAATCCAGAGATACAGAATGG + Intergenic
1079641767 11:22814440-22814462 TAAGATCCAAAGAAGGACAATGG + Intronic
1079685130 11:23349937-23349959 TAAAATCCATAAATGTAGAGTGG + Intergenic
1079890599 11:26048150-26048172 TAGAATCCAGGGAGGAAGAATGG - Intergenic
1079931585 11:26569716-26569738 TGAACTCCAGAGATGGAGAGAGG - Intronic
1080007729 11:27427535-27427557 TATAATACAGAGTTTGAGAATGG + Intronic
1080080956 11:28217818-28217840 CAAAAACAAGAAATGGAGAAAGG - Intronic
1080082212 11:28235065-28235087 CAAAAACAAGAAATGGAGAAAGG - Intronic
1080235412 11:30062897-30062919 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1080365158 11:31565633-31565655 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080522898 11:33083081-33083103 TAAAATACAGAGATGTAGGCTGG - Intronic
1080792057 11:35530195-35530217 CCAAGGCCAGAGATGGAGAAGGG + Intronic
1080810462 11:35699044-35699066 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080811375 11:35707644-35707666 CAAAAACAAGAGATGGGGAAAGG + Intronic
1080915312 11:36651812-36651834 CAAAAACAAGAGATGGGGAAAGG - Intronic
1080917909 11:36678798-36678820 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1081037339 11:38165258-38165280 TAAAAATAAGAAATGGAGAAAGG - Intergenic
1081146634 11:39568906-39568928 TAAAATCAAGAGAAACAGAAAGG + Intergenic
1081162764 11:39771469-39771491 TAAGAGCAAGAGATGTAGAAGGG + Intergenic
1081193391 11:40131792-40131814 TAAAGTCCGTATATGGAGAATGG + Intronic
1081354973 11:42101527-42101549 GATAATCAAGTGATGGAGAAAGG + Intergenic
1081499753 11:43654655-43654677 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081505703 11:43714383-43714405 CAAAATCAAGAAATGGGGAAAGG - Intronic
1081887012 11:46506694-46506716 TAAAAGCAAGAGAGAGAGAAGGG - Intronic
1081958400 11:47114107-47114129 CAAAATCAAGAAATGGGGAAAGG - Intronic
1082232928 11:49791272-49791294 GCAAATCCAGAGATGTAGATGGG + Intergenic
1082269426 11:50153722-50153744 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1082648709 11:55760184-55760206 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1082723771 11:56710668-56710690 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1082885205 11:58074865-58074887 CAAAAACAAGAAATGGAGAAAGG - Intronic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083165749 11:60885940-60885962 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1083910155 11:65703056-65703078 AAAATTCCAGAGCTGGAAAATGG + Intergenic
1084168019 11:67385789-67385811 GAAAACCCAGAGAGGGAGAGAGG - Intronic
1085150749 11:74251288-74251310 CAAAAGCCAGAGATGGAAGAGGG + Intronic
1085227453 11:74935205-74935227 TAACATCCTGAGGTAGAGAAGGG - Intronic
1085248433 11:75124188-75124210 TAAAAACAAGAAATGGGGAAAGG + Intronic
1086260346 11:84932377-84932399 TCAAATCAAGCAATGGAGAAAGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086612436 11:88773711-88773733 TAAAAACAAGAAATGGGGAAAGG - Intronic
1087083111 11:94190911-94190933 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1087303245 11:96459730-96459752 AAAAATCCATTGAAGGAGAATGG + Intronic
1087398534 11:97634228-97634250 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1087560779 11:99786736-99786758 CCAAAACCAGAAATGGAGAAAGG + Intronic
1087577327 11:100005422-100005444 TAAAAAAGAGAGTTGGAGAATGG - Intronic
1087674560 11:101144855-101144877 TAAACTTCAGTGATGAAGAAAGG - Intergenic
1088206632 11:107399358-107399380 TAAAATAAAGGGATGGAAAAAGG + Intronic
1088211500 11:107461770-107461792 CAAAATCAAGAAATGGAGAAAGG - Intergenic
1088228673 11:107650229-107650251 TTGAATCCAGAGATGGATACTGG - Intronic
1088679166 11:112224600-112224622 TAAAAACAAGAAATGGGGAAAGG + Intronic
1088703457 11:112436170-112436192 TACATTCCAGTAATGGAGAAAGG - Intergenic
1089589326 11:119530451-119530473 AAAAAGCCAGAGCTGGGGAAGGG + Intergenic
1090315464 11:125783422-125783444 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1090480428 11:127062797-127062819 TGAACTCCAGAGATGGCAAATGG + Intergenic
1090638595 11:128710241-128710263 AAAAATGAAGAGATGAAGAAAGG + Intronic
1090933147 11:131317396-131317418 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1091525335 12:1294250-1294272 TAAAATTTAAAGAAGGAGAAAGG - Intronic
1092080636 12:5713178-5713200 TAAATACCAGAGATGGTGAGTGG + Intronic
1092206400 12:6616822-6616844 GAAAATCCAAAGATAGAGAAGGG - Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1092828470 12:12420305-12420327 TAAAAACAAGAAATGGGGAAAGG - Intronic
1093195487 12:16125361-16125383 TAGAATGTAGAGATTGAGAAGGG + Intergenic
1093205567 12:16244610-16244632 AAAAATGAAGAGAGGGAGAAGGG + Exonic
1093256527 12:16874662-16874684 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1093265300 12:16996620-16996642 TAAAATCTAATGATGGAAAAGGG - Intergenic
1093293055 12:17352949-17352971 TACAATCCAGTGATAGAGCAAGG - Intergenic
1093350365 12:18092453-18092475 CAAAAACAAGAAATGGAGAAAGG - Intronic
1093905374 12:24685131-24685153 CAAAAACAAGCGATGGAGAAAGG - Intergenic
1095436877 12:42198690-42198712 TAAAATTCCGAAATGGAGAGCGG + Intronic
1095590126 12:43893932-43893954 TACCATGCAGAGGTGGAGAAAGG - Intronic
1095734601 12:45542752-45542774 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1096950533 12:55464186-55464208 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1097321192 12:58228199-58228221 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1097453446 12:59765592-59765614 CAAAATCAAGAAATGGGGAAAGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1098821746 12:75239794-75239816 TTAAATGCAGAGATGAAGATAGG - Intergenic
1098855203 12:75644974-75644996 TAAACCACAGAGATTGAGAATGG - Intergenic
1099483646 12:83199856-83199878 TAAAAACCAGAGATGAGAAAAGG + Intergenic
1099511606 12:83545630-83545652 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1099696020 12:86020467-86020489 CAAAAACAAGAGATGGGGAAAGG + Intronic
1099744492 12:86685295-86685317 TAAAAACAAGAAATGGGGAAAGG - Intronic
1099853537 12:88135632-88135654 TAAAATACATACATGAAGAATGG + Intronic
1100417574 12:94394356-94394378 TAAAAACAAGCAATGGAGAAAGG + Intronic
1100891954 12:99135500-99135522 AAACTTCCAGAGAGGGAGAAAGG + Intronic
1101090252 12:101278045-101278067 TAAATTGCAGAGAAGGAAAATGG + Intergenic
1101698478 12:107149456-107149478 GTAAATGCTGAGATGGAGAAGGG - Intergenic
1101785536 12:107880023-107880045 TACAAGCCAGAGTTGAAGAACGG - Intergenic
1101802012 12:108030693-108030715 TAGAAGCAAGAGATGGAGATGGG + Intergenic
1102744336 12:115237133-115237155 CAGAATCCATTGATGGAGAACGG + Intergenic
1102886519 12:116526118-116526140 GAAAAGACAGAGAAGGAGAAAGG - Intergenic
1104255813 12:127137019-127137041 AAAAGTAAAGAGATGGAGAAAGG - Intergenic
1105914589 13:24901419-24901441 TCAACTCCAGTGATGGGGAAAGG + Intronic
1106094546 13:26631431-26631453 CAAAAACAAGAAATGGAGAAAGG - Intronic
1106347843 13:28896783-28896805 CAAAAACAAGAAATGGAGAAAGG + Intronic
1106442105 13:29784663-29784685 AAAATTATAGAGATGGAGAATGG + Intronic
1106617693 13:31345239-31345261 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1107781978 13:43913137-43913159 GAACAGCCAGAGAGGGAGAAGGG + Intergenic
1108070464 13:46623858-46623880 TAAAAAACAGAGATGGGGAGGGG - Intronic
1108154201 13:47568765-47568787 CAAAAACAAGCGATGGAGAAAGG + Intergenic
1108234045 13:48382954-48382976 CAAAAACAAGAAATGGAGAAAGG - Intronic
1108363988 13:49691993-49692015 AAAAATCCAGAAAAGTAGAAGGG + Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1109088108 13:58002055-58002077 TACCATCCAGAGATTGAGAGTGG - Intergenic
1109264502 13:60181642-60181664 TAAAATACTGAGATGGATTAAGG - Intergenic
1109816642 13:67593200-67593222 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1109873123 13:68363656-68363678 AAAAATCCAGAGGAGGAGGAAGG + Intergenic
1109964312 13:69671607-69671629 GAAAAACAAGAAATGGAGAAAGG + Intergenic
1110480815 13:75973798-75973820 TAAAATTCTGGAATGGAGAAAGG - Intergenic
1110527894 13:76560765-76560787 TAAAATGCAAATATGGAGAGAGG - Intergenic
1110669691 13:78162545-78162567 TAACATCCAGAGATGGCGTTGGG - Intergenic
1110699563 13:78530921-78530943 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1110890722 13:80694479-80694501 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1111137434 13:84066672-84066694 GCAAATCCAGAATTGGAGAAAGG + Intergenic
1111971434 13:94921320-94921342 TAGACTCCTCAGATGGAGAAGGG + Intergenic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112635843 13:101217526-101217548 TAAGCCCAAGAGATGGAGAAGGG - Intronic
1112909632 13:104465124-104465146 TAAAACCAAGAGATGGAAATAGG - Intergenic
1113203938 13:107895080-107895102 TTAAATCAAGAGAGGGAGAAGGG + Intergenic
1113308670 13:109107704-109107726 ATAATTCCAGAGAAGGAGAAAGG - Intronic
1114044131 14:18706993-18707015 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1114144837 14:19963043-19963065 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1114259745 14:21027794-21027816 TATAATTCAGAGAAGGAAAAGGG + Intronic
1114602286 14:23966518-23966540 GAAAGTCCAGGGAAGGAGAATGG - Intronic
1114606453 14:24001618-24001640 GAAAGTCCAGGGAAGGAGAATGG - Intronic
1114692112 14:24593484-24593506 TAAAAACAAGCAATGGAGAAAGG - Intergenic
1114808048 14:25860720-25860742 TAAAACCCAGAGATAGCAAATGG - Intergenic
1115005181 14:28473982-28474004 CAAAAACAAGAGATGGGGAAAGG - Intergenic
1115008967 14:28521495-28521517 TAAAATCCAATCATGGGGAAAGG - Intergenic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115798227 14:36962525-36962547 TAAAAAAGAGAGATAGAGAATGG - Intronic
1116006711 14:39300197-39300219 TAAAATACAGAGAAGAAAAAAGG - Intronic
1116112650 14:40606526-40606548 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1116136324 14:40928514-40928536 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1116442755 14:44972720-44972742 AAAAGTAAAGAGATGGAGAAAGG - Intronic
1116488106 14:45475801-45475823 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1117253693 14:53957256-53957278 TAAAATCAGGTTATGGAGAAAGG + Intronic
1117265805 14:54085663-54085685 TAAAAACAAGAGATTGAGAAAGG + Intergenic
1117581177 14:57153267-57153289 CAAAAGCCAGAGATGTAGATGGG + Intergenic
1118304209 14:64641078-64641100 TATAATCAAGGGATGGAGTAGGG + Intergenic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118700687 14:68430007-68430029 CAAAATCAAGAAATGGGGAAAGG - Intronic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120115716 14:80615290-80615312 TAATATCCAGAGAATGATAAGGG + Intronic
1120137722 14:80889509-80889531 CAAAAACAAGAAATGGAGAAAGG + Intronic
1120614328 14:86684079-86684101 TAAATTATAGAAATGGAGAATGG + Intergenic
1121934396 14:98003955-98003977 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1122004902 14:98694813-98694835 TGAAAACCAGAGATGGAGAGTGG + Intergenic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122391609 14:101392056-101392078 TAACTTCTAGAGATGGAGAATGG - Intergenic
1122578743 14:102757977-102757999 TGACATCCAGAGCTGGGGAAAGG + Intergenic
1123832414 15:24154406-24154428 TAAGATCCTGTGATGGAGCAGGG + Intergenic
1123837946 15:24214870-24214892 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123866527 15:24524547-24524569 TAAGATCCTGTGATGGAGCAGGG - Intergenic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1124406940 15:29401497-29401519 TAAAACCCAGTGATGGCAAAGGG + Intronic
1124878091 15:33615098-33615120 TAAAATACAGGGATGAAGAATGG - Intronic
1124970605 15:34486388-34486410 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1125489143 15:40133710-40133732 TAATATCCAGCGGGGGAGAAGGG - Intergenic
1126119773 15:45241318-45241340 TAAATTGCAGAAATGGAGAGGGG + Intergenic
1126240143 15:46432735-46432757 TAGAATGCAGAAATGCAGAAGGG + Intergenic
1126522263 15:49608354-49608376 ATAAAACTAGAGATGGAGAAGGG + Intronic
1127212542 15:56788817-56788839 TAAAAACAAGAAATGGGGAAAGG + Intronic
1127527510 15:59808217-59808239 CAAAAGCAAGAAATGGAGAAAGG + Intergenic
1127543264 15:59964592-59964614 TAAAATCCTAAAATGGAAAAAGG + Intergenic
1127796936 15:62446593-62446615 TGAAGTCCAGAGATGTAAAACGG - Intronic
1128231462 15:66038388-66038410 TAAAATCGAGGGATGGTTAAGGG + Intronic
1129585165 15:76855157-76855179 CAAAAACAAGATATGGAGAAAGG + Intronic
1130205319 15:81870077-81870099 TAAAAAAAAGAGATAGAGAATGG - Intergenic
1131947580 15:97643532-97643554 TAAAATCAAGCAATGGGGAAAGG + Intergenic
1132476586 16:142262-142284 TAAAATCAAAACATGGACAACGG - Intergenic
1132907458 16:2290194-2290216 GAGAATCCAGTGAGGGAGAAGGG - Intronic
1133110185 16:3543393-3543415 TAAAGACCATAGATGGAGACTGG + Intronic
1133912975 16:10082653-10082675 TCAAAACCAGTGATGGAGAGTGG - Intronic
1134405267 16:13952629-13952651 TAAATTCCAGAGGTGTTGAAAGG - Intergenic
1135474207 16:22759883-22759905 TAGAAACTAGGGATGGAGAAGGG - Intergenic
1135475404 16:22770260-22770282 TAATTGCCAGAGATGGACAATGG + Intergenic
1135862764 16:26072011-26072033 CAAAATCCAAAGATAGGGAAAGG - Intronic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1137413927 16:48254620-48254642 TAAAATTCAGAGATGGAGGCCGG - Intronic
1138086987 16:54142395-54142417 TAAAATAGAGAGTTGGAGGAGGG + Intergenic
1138163432 16:54777362-54777384 AAAAATCCAGAAGTGGAGAACGG + Intergenic
1138256571 16:55568982-55569004 TAAAAATCAGAGAAGCAGAATGG - Intronic
1138338287 16:56269847-56269869 TATGATTCAGAGAAGGAGAATGG + Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139215388 16:65121685-65121707 TAAAAATCAGAAAGGGAGAAGGG - Intronic
1139341775 16:66272105-66272127 TAAAACCTTGGGATGGAGAAAGG + Intergenic
1139452050 16:67036317-67036339 TTAAATGCAGAGATGGATAGTGG + Intronic
1139800298 16:69517162-69517184 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1140711541 16:77682834-77682856 TGGAATCCTCAGATGGAGAAAGG + Intergenic
1141170768 16:81689914-81689936 TAAAAACAAGAAATGGGGAAAGG - Intronic
1143267671 17:5652615-5652637 TAAAAGCAAGGGAAGGAGAAAGG + Intergenic
1143325101 17:6093480-6093502 CACAATCCAGAGATGGGGGAGGG - Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1144158211 17:12529024-12529046 TAAAATACAGAGATTGAGGCTGG - Intergenic
1144176278 17:12710789-12710811 TCAAATTCAGAGATAGAAAAAGG + Intronic
1144699332 17:17326604-17326626 TGAAACCCAAGGATGGAGAAAGG - Intronic
1144888200 17:18478021-18478043 TAGACTCCAGAGAGGAAGAATGG + Intronic
1145144006 17:20466282-20466304 TAGACTCCAGAGAGGAAGAATGG - Intronic
1145791860 17:27632425-27632447 TAAACTCCAGAGAGAAAGAATGG + Intronic
1145815458 17:27792181-27792203 TAACATCCAGCCATGGACAATGG - Intronic
1146812477 17:35914908-35914930 GAGAATCCAGAGGTGGGGAAGGG + Intergenic
1147029179 17:37616946-37616968 TAAAATTTAGGCATGGAGAAGGG - Intronic
1147279583 17:39347951-39347973 CAAAATCAAGAAATGGAGAAAGG - Intronic
1147492112 17:40879311-40879333 TAAAATTTTAAGATGGAGAATGG - Intronic
1148535566 17:48435733-48435755 TAGAATTCAGAGTTGGAGCAGGG + Intergenic
1148682844 17:49484525-49484547 AAAGAACCAGAGAAGGAGAAAGG - Intergenic
1149134318 17:53346396-53346418 GAAAAACCAGAAATGGGGAAAGG + Intergenic
1150166672 17:62950600-62950622 TTAACTCTAGAGAAGGAGAATGG - Intergenic
1150753686 17:67890465-67890487 TAAAATCCAGAGATGGAGAAGGG - Intronic
1150856250 17:68755808-68755830 TAAAAGGAAGAGGTGGAGAAGGG - Intergenic
1151583788 17:74995958-74995980 CTTAATCCAGAGACGGAGAAGGG - Intronic
1153686764 18:7553946-7553968 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1153980130 18:10301713-10301735 GAAAACTCAGAGAGGGAGAATGG - Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1154106510 18:11528076-11528098 TGAAATCCTGAGATTGAGATAGG + Intergenic
1154175403 18:12084705-12084727 TAAAATCAAGAGATAAAAAAAGG - Intergenic
1154199480 18:12289348-12289370 AAAGATCCAGAGATGGGGAAGGG + Intergenic
1155178800 18:23325147-23325169 TGAAATCCAGAGATGGGGATGGG - Intronic
1155317308 18:24584887-24584909 TAAAAAACAGAGAAGGAGATGGG + Intergenic
1155412040 18:25557113-25557135 TAAGAGCCAGTGATTGAGAAGGG - Intergenic
1155542661 18:26884326-26884348 TAATACCCAGAGAGGGAGAAGGG + Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155681318 18:28490367-28490389 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1156133594 18:34008091-34008113 TAAAAGAAAGAGGTGGAGAAAGG + Intronic
1156141560 18:34118129-34118151 TAAAAACAAAAGGTGGAGAAAGG - Intronic
1156433124 18:37097333-37097355 CAAAAACAAGAAATGGAGAAAGG - Intronic
1156476857 18:37410916-37410938 TGAGATCCAGAGATGGGGAGAGG + Intronic
1156512208 18:37647554-37647576 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1157024956 18:43831518-43831540 AAAAACCCAGAGATCAAGAATGG + Intergenic
1157398905 18:47369620-47369642 AAAAATCTAAAGCTGGAGAATGG - Intergenic
1157845757 18:51002422-51002444 CAAAAACAAGAAATGGAGAAAGG + Intronic
1157898994 18:51495440-51495462 GGGAACCCAGAGATGGAGAATGG - Intergenic
1158200688 18:54936458-54936480 CCAAATCCAGAGAGGAAGAATGG + Intronic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1158946642 18:62452675-62452697 TAAACTTCAGAGAGTGAGAAAGG - Intergenic
1159102783 18:63973746-63973768 CAAAAACAAGAAATGGAGAACGG - Intronic
1159178271 18:64867066-64867088 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1159628234 18:70719172-70719194 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1159630230 18:70740714-70740736 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159823731 18:73178732-73178754 GAGAATCAAGAGATGGAGAGGGG + Intronic
1162412183 19:10513169-10513191 TGAAAACCAGAGAAGGTGAAGGG - Exonic
1162616716 19:11807392-11807414 TAAAATGTAGAGATGGAGTTAGG + Exonic
1162628938 19:11910552-11910574 TAAAAACAAGAAATGGGGAAAGG + Intronic
1164488407 19:28683353-28683375 TAAAATTCAGACAAGTAGAAAGG - Intergenic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1164992968 19:32697865-32697887 TTAAAATCAGAGAGGGAGAAGGG + Intronic
1165847063 19:38824948-38824970 TTTAAATCAGAGATGGAGAAGGG - Intronic
1165957714 19:39512123-39512145 AAAGAGCCTGAGATGGAGAATGG - Intergenic
1166191220 19:41178147-41178169 TCAAATACAGACATGGAGAAAGG - Intergenic
1167553794 19:50179882-50179904 TAAAATTCAGATATGGGGGAAGG + Intergenic
1167829411 19:52007504-52007526 TAAAAACCAGTCGTGGAGAAGGG + Intronic
925198853 2:1950199-1950221 GAAAATCAGGACATGGAGAAGGG - Intronic
925377375 2:3397588-3397610 TTATATCCAGAGATCTAGAAAGG - Intronic
925672743 2:6328742-6328764 TAAAAACAAGAAATGGGGAAAGG - Intergenic
926078803 2:9966549-9966571 TAAAAAACAGAGACTGAGAAAGG - Intronic
926482311 2:13414417-13414439 AAAAATCATGAGATGAAGAACGG + Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
926833952 2:16997353-16997375 GAAAAACAAGAAATGGAGAAAGG - Intergenic
927173002 2:20386374-20386396 TGAAGTCCTGAGATGGAGAGAGG + Intergenic
927305100 2:21562240-21562262 GAGAAGCCAGAGATGGAGGAAGG + Intergenic
927381986 2:22489800-22489822 TTAAAGTCAAAGATGGAGAAGGG + Intergenic
928041453 2:27881800-27881822 TAAAAACAAGCAATGGAGAAAGG + Intronic
928480601 2:31679349-31679371 TAAAAACAAGAAATGGGGAAAGG - Intergenic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
929343789 2:40855897-40855919 CAAAAACAAGAAATGGAGAAAGG + Intergenic
929910420 2:46085030-46085052 TACAATCCAGGGGTGGAGATGGG - Intronic
930289397 2:49474810-49474832 TAATCCCCAGTGATGGAGAAGGG + Intergenic
930368885 2:50479237-50479259 GAAAATGCAGAGTTGGGGAAAGG - Intronic
930451260 2:51540901-51540923 CAAAAACAAGAAATGGAGAAAGG + Intergenic
931015503 2:57975471-57975493 TAAAAAATAGAGATGGAGGAAGG - Intronic
931345943 2:61446497-61446519 TAAAATCCAGTGATGTAGGCTGG + Intronic
931558916 2:63535592-63535614 CAAAAACAAGAAATGGAGAAAGG + Intronic
931980422 2:67688238-67688260 TATAATCCAGAAAGGGAGAGGGG + Intergenic
932662240 2:73665756-73665778 TAAAAACAAGAAATGGGGAAAGG - Intergenic
932996895 2:76866067-76866089 TTACATTCAGAGATGGGGAAAGG - Intronic
933202307 2:79465243-79465265 CAAAAACAAGAAATGGAGAAAGG - Intronic
933798231 2:85938268-85938290 TAGAAACCAGAGATGGAATAAGG - Intergenic
933929947 2:87139913-87139935 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
934001280 2:87715698-87715720 AAAAAAAAAGAGATGGAGAAAGG - Intergenic
935260182 2:101348364-101348386 TTAAACCTAGAGATGGAGATGGG + Exonic
935937068 2:108197670-108197692 CAAAAACAAGAAATGGAGAAAGG + Intergenic
935937696 2:108204395-108204417 CAAAAACAAGAAATGGAGAAAGG - Intergenic
936265888 2:111006329-111006351 GAAACTCCAGAGATAGGGAAAGG + Intronic
936362992 2:111823502-111823524 AAAAAAAAAGAGATGGAGAAAGG + Intronic
937058068 2:118956278-118956300 TAAAATAAAGGGGTGGAGAAAGG + Intronic
937298575 2:120824563-120824585 TTACAGCCAGAGATGGAGCAGGG - Intronic
937518533 2:122683553-122683575 TAAAATACTGAAATGGATAAAGG - Intergenic
939044998 2:137239525-137239547 TAAACACCAGAAAGGGAGAAGGG - Intronic
940053141 2:149485168-149485190 TTACATCTTGAGATGGAGAAGGG + Intergenic
940082546 2:149820860-149820882 CAAAAACAAGAAATGGAGAAAGG - Intergenic
940449434 2:153818783-153818805 TAAAATGCTCAGATGGAGCAGGG - Intergenic
940720326 2:157275088-157275110 CAAAAACAAGAAATGGAGAAAGG - Intronic
940761122 2:157740516-157740538 AAAAATTGAGAGATGGTGAAGGG - Intronic
940873558 2:158880045-158880067 TAATATCCAGTGAAGGAGAGGGG + Intergenic
940875993 2:158897643-158897665 TAAACTCAGGAGATGGAAAAAGG - Intergenic
941035469 2:160563926-160563948 CAAAAACCTAAGATGGAGAAAGG + Intergenic
941035643 2:160566093-160566115 AGAACTCCAGAGATGGAGGATGG + Intergenic
941197812 2:162471969-162471991 CAAAAACAAGAAATGGAGAAAGG + Intronic
941265466 2:163356348-163356370 TATAATACAGGGAAGGAGAATGG + Intergenic
941533851 2:166698278-166698300 TAATATCCAGGGAGGGAGAGGGG - Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942303341 2:174583531-174583553 TAGAATATAGAGATGAAGAAAGG - Intronic
942698770 2:178679167-178679189 TAAAATTCAGAGATGAATACCGG + Intronic
942836036 2:180299664-180299686 CAAAAACAAGAAATGGAGAAAGG - Intergenic
943256878 2:185605604-185605626 TAAAATCTAGAAATAGAGATGGG + Intergenic
943987687 2:194643627-194643649 CAAAAACAAGAGATGGGGAAAGG + Intergenic
944448865 2:199820689-199820711 GAGAATCCAGATATGAAGAATGG - Intronic
944463805 2:199980118-199980140 TCACATCAAGAAATGGAGAAAGG - Intronic
944955307 2:204800971-204800993 TAAAAACAAGAAATGGGGAAAGG - Intronic
945208391 2:207356739-207356761 TAAAGTCCAGAGATGAAGAAAGG - Intergenic
945588041 2:211691854-211691876 TAAACTGGTGAGATGGAGAAGGG + Intronic
945735916 2:213600199-213600221 TGAAATGGAGAGTTGGAGAAAGG - Intronic
946293934 2:218767924-218767946 TAAAAACAAGAAATGGGGAAAGG - Intergenic
946346761 2:219117218-219117240 TAAAATGAAGGGGTGGAGAAGGG - Intronic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
946981802 2:225225958-225225980 AAAACTACAGAGATGGAGAAAGG + Intergenic
946991533 2:225336322-225336344 TTAAATCCTGAGATGCTGAATGG + Intergenic
947213694 2:227730684-227730706 TGAAAGCAAGGGATGGAGAAAGG + Intergenic
947707152 2:232285515-232285537 TAGAATCTAGAGAAGGGGAAAGG + Intronic
947899651 2:233711003-233711025 AAAAATTCAGAGATAGAAAAAGG - Intronic
1168885846 20:1254133-1254155 TAAAATCCTTAAATGGAAAAAGG - Intronic
1169010162 20:2243865-2243887 CAAAATCCATAAAGGGAGAAGGG + Intergenic
1169669311 20:8077887-8077909 TAGATTCCAGAGATAGAAAAGGG + Intergenic
1170588924 20:17756408-17756430 TAACAGCCAGAGAAGCAGAAGGG + Intergenic
1171107766 20:22451536-22451558 AAAAATCCAGAATTGGTGAAGGG + Intergenic
1171200520 20:23237471-23237493 CAAAATCAAGCAATGGAGAAAGG - Intergenic
1173228410 20:41175500-41175522 AAAGATCCAGGGATGGAGATGGG + Exonic
1173600699 20:44292920-44292942 GAAAATCCAGAGTGGGAGACAGG + Intergenic
1173885722 20:46457456-46457478 TAAATTCCAGATGTGGAGATGGG + Intergenic
1174126997 20:48313972-48313994 AAAAAGCCAGATGTGGAGAATGG - Intergenic
1174477790 20:50809092-50809114 CAAAAACCAGAAGTGGAGAAAGG - Intronic
1174967929 20:55240300-55240322 TAATTTCCAGTGTTGGAGAAGGG + Intergenic
1174994147 20:55546505-55546527 TCAGATCCAAAGATGGATAAAGG + Intergenic
1177571753 21:22895857-22895879 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1177693061 21:24535631-24535653 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1178036860 21:28594275-28594297 TGAAATTCAGAGATAGAGAAAGG + Intergenic
1178341845 21:31792210-31792232 TAAAATCCAGAGCAGTGGAAAGG + Intergenic
1178486354 21:33022108-33022130 TGAGAACCTGAGATGGAGAAAGG + Intergenic
1178590698 21:33907237-33907259 TAAAATCAAGAAATTGGGAAAGG - Intronic
1178618072 21:34151278-34151300 TAATCTCCAGTGTTGGAGAAGGG - Intergenic
1178826484 21:36021250-36021272 TCAAAGCCAGTGATGGAGAGAGG + Intergenic
1178864204 21:36314575-36314597 TAAAAACAAGCGATGGGGAAAGG - Intergenic
1179083183 21:38192389-38192411 TAAAATTCAGAGAATGATAAAGG - Intronic
1179191781 21:39128699-39128721 AAAGTTCCAGAGATGGATAATGG - Intergenic
1179925483 21:44531836-44531858 TGAACTCCGGAGATGGAGCAAGG + Intronic
1183249752 22:36722064-36722086 TAAAATCTAATGATGAAGAAAGG + Intergenic
1184307101 22:43612042-43612064 CAAAACCCAGCAATGGAGAAAGG + Intronic
1184624294 22:45711324-45711346 AAAATTACAGAAATGGAGAACGG + Intronic
949096742 3:95389-95411 CAAAATCTAGAGATTGAAAAAGG - Intergenic
949673600 3:6427110-6427132 TAAAATCCCGAGTTAGAGATTGG - Intergenic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
951188609 3:19743176-19743198 TAAAATCCAGAGAAGAGGGAGGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951987797 3:28640300-28640322 TAAAATAAAAAGATGGAGAAGGG - Intergenic
952106791 3:30079257-30079279 AAAAAGAGAGAGATGGAGAAGGG - Intergenic
952137382 3:30438370-30438392 TAAAAGCCAGAGATGCGTAAGGG - Intergenic
952221532 3:31328414-31328436 TACAAGCCAGAGCAGGAGAAAGG + Intergenic
952692522 3:36226585-36226607 CAAAAACCAGAAATGGAGAAAGG + Intergenic
952848296 3:37707105-37707127 TAAAATCCAGACTTTGAAAAAGG + Intronic
953080861 3:39616253-39616275 CAAAATCAAGAAATGGGGAAAGG - Intergenic
953104427 3:39862075-39862097 TTAAAGCCAGAGAGAGAGAAGGG + Intronic
953116818 3:40000900-40000922 TCAAATCCAGGGTAGGAGAAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953485497 3:43290720-43290742 AAAAATCCTGAGCAGGAGAATGG - Intronic
953530859 3:43738510-43738532 TAAAGCCCAGAGAGGGAGACAGG + Intergenic
953539348 3:43802142-43802164 CAAAAACAAGAAATGGAGAAAGG - Intergenic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
953779687 3:45856267-45856289 TAAAAACAAGCAATGGAGAAAGG + Intronic
954189278 3:48944958-48944980 TAAAAAGCAGAAATGAAGAAAGG - Intronic
954944069 3:54402195-54402217 AAAAAACAAGAGAGGGAGAAGGG + Intronic
954988270 3:54814809-54814831 TAAAATAGAGAGAGAGAGAAAGG + Intronic
955282875 3:57611114-57611136 CAAAAACAAGAAATGGAGAAAGG + Intergenic
955469098 3:59267677-59267699 TAAATTCCAGAGATATATAAAGG - Intergenic
955642531 3:61101320-61101342 CAAAATCAAGAAATGGGGAAAGG - Intronic
955895857 3:63699104-63699126 GAAAAACAAGAAATGGAGAAAGG + Intergenic
956220654 3:66899022-66899044 TAAAAACAAGAAATGGGGAAAGG + Intergenic
957395204 3:79627382-79627404 CAAAATCAAGCAATGGAGAAAGG + Intronic
957417174 3:79920188-79920210 AAAAATACAGAGCTGGACAATGG - Intergenic
957629639 3:82702673-82702695 CAAAAACAAGTGATGGAGAAAGG - Intergenic
957916047 3:86689044-86689066 GAAAATGCAGGGATTGAGAAAGG + Intergenic
957990971 3:87627344-87627366 TAAAATCCACAGCAGCAGAAAGG + Intergenic
958030208 3:88099705-88099727 CAAAAACAAGAAATGGAGAAAGG + Intronic
958176367 3:90000835-90000857 CAAAAACAAGAAATGGAGAAAGG + Intergenic
958507550 3:94999460-94999482 TAAAAACCAGCAATGGGGAAAGG - Intergenic
958634125 3:96721000-96721022 AAATCTTCAGAGATGGAGAAAGG + Intergenic
958640829 3:96801870-96801892 TAAAAACCATATATGCAGAAAGG - Intergenic
958802805 3:98776266-98776288 TAAACTCCAGAAAGGCAGAATGG + Intronic
958953904 3:100446331-100446353 CAAAAACAAGAAATGGAGAAAGG + Intronic
959420693 3:106124632-106124654 TAAAAGCCAGAGTAGGAGATGGG - Intergenic
959939717 3:112068084-112068106 CAAAAACAAGAAATGGAGAAAGG - Intronic
959955619 3:112234737-112234759 CAAAAACAAGAAATGGAGAAAGG - Intronic
960058898 3:113298392-113298414 TTGGATCTAGAGATGGAGAAAGG + Intronic
960193815 3:114740707-114740729 TAAACTCCAGTGATAGAGAAAGG - Intronic
960319921 3:116222033-116222055 CAATATCAAGTGATGGAGAATGG - Intronic
960770215 3:121185557-121185579 CAAAAACAAGAAATGGAGAAAGG - Intronic
960911780 3:122656527-122656549 CAAAAACAAGAAATGGAGAAAGG + Intergenic
961291400 3:125849568-125849590 TTAAAACTAGAGAGGGAGAAAGG + Intergenic
961527609 3:127516433-127516455 TAAAAACAAGAAATGGGGAAAGG + Intergenic
961615618 3:128177405-128177427 TAAAATCCAGAGATGCGGGTGGG - Intronic
962035261 3:131644560-131644582 TAAAATCTGGACATGGAAAATGG - Intronic
962052948 3:131837485-131837507 AAAATTACAGTGATGGAGAACGG + Intronic
962083930 3:132170807-132170829 TAAGGTCCATAGATGGACAAGGG - Intronic
962732729 3:138298798-138298820 TACAATTCAGAGATGGGAAAAGG - Intronic
962861732 3:139409466-139409488 CAAAAACAAGAAATGGAGAAAGG + Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963551547 3:146730360-146730382 TAAAATCAAGCAATGGAGAAAGG + Intergenic
963787019 3:149545254-149545276 CAAAATCCAGACATCCAGAAGGG + Intronic
963945217 3:151138504-151138526 TAAGATCCTGAAATGGAAAAGGG - Intronic
964427599 3:156569604-156569626 TAAACTGCAGAGTAGGAGAAGGG + Intergenic
964429585 3:156590900-156590922 CAAAAACCAGAAATGGGGAAAGG - Intergenic
964500662 3:157344907-157344929 CAAAAACCAGAAATGGGGAAAGG + Intronic
965417934 3:168420664-168420686 TAAAGTCCATATATGGTGAATGG + Intergenic
965494145 3:169377059-169377081 TAAAAACAAGAAATGGGGAAAGG + Intronic
966396150 3:179505412-179505434 TAATATCCAGAGTCAGAGAAGGG + Intergenic
966470472 3:180283296-180283318 TAGAAGCCAGAGATAGAGATGGG - Intergenic
967247683 3:187504400-187504422 TAAATTGCAGTGATGGACAACGG - Intergenic
967594583 3:191314702-191314724 CAACCTCCAGAGATGGGGAAGGG + Intronic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971080515 4:23204969-23204991 TAAAAACAAGCAATGGAGAAAGG - Intergenic
971466720 4:26971503-26971525 CAAAAACAAGAAATGGAGAAAGG - Intronic
971602729 4:28615863-28615885 CAAAAACCAGAAATGGGGAAAGG - Intergenic
971706325 4:30048117-30048139 TAAAAACAAGAAATGGGGAAAGG + Intergenic
971875839 4:32307492-32307514 TAAAATACATATATGGAGAAGGG + Intergenic
972196609 4:36660914-36660936 GAAAAACAAGAAATGGAGAAAGG + Intergenic
972387590 4:38582725-38582747 TAGAATCCAGAGGAGAAGAATGG - Intergenic
972427612 4:38948921-38948943 TAAAATCCTGAGAGAGAAAAAGG - Intergenic
972507467 4:39733862-39733884 TATAAGCAAGACATGGAGAATGG - Intronic
972694366 4:41430558-41430580 TAAAATACAGAGATGGGGGCAGG - Intronic
973112110 4:46409530-46409552 CAAAAACAAGAAATGGAGAAAGG + Intronic
973171966 4:47156638-47156660 TAAAATCTAGAGATGATTAAAGG - Intronic
973315716 4:48757967-48757989 CAAAAACAAGAAATGGAGAAAGG + Intronic
973610141 4:52628461-52628483 TAAAAAACAGAGAAAGAGAAGGG + Intronic
973875186 4:55210662-55210684 TAAAAACAAGAAATGGGGAAAGG + Intergenic
974559912 4:63504336-63504358 TAAAAACAAGAAATGGGGAATGG - Intergenic
974583818 4:63843415-63843437 TTAAATACAGAAATGGAGAAAGG + Intergenic
974694822 4:65352770-65352792 AAAAATGCAGAGAAGTAGAAGGG - Intronic
974785233 4:66610455-66610477 TAAAATCTAGTAAAGGAGAACGG - Intergenic
974966673 4:68769470-68769492 CAAAAACAAGAAATGGAGAAAGG - Intergenic
974979669 4:68939430-68939452 CAAAATCAAGAAATGGAGAAAGG + Intronic
975218057 4:71780115-71780137 CAAAAACAAGAAATGGAGAAAGG + Intronic
975304759 4:72836757-72836779 TGAAAACCAGAAATGGGGAAAGG - Intergenic
976834058 4:89349770-89349792 CAAAAACAAGAAATGGAGAAAGG - Intergenic
977449091 4:97171595-97171617 TAAAATCAAATGAGGGAGAACGG - Intergenic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977855464 4:101885338-101885360 TAAACTGGAGAGAAGGAGAAGGG - Intronic
977968959 4:103190524-103190546 TAAAAACAAGAAATGGAGAAAGG + Intronic
977977215 4:103279623-103279645 CAAAATCAAGAAATGGGGAAAGG + Intergenic
978002862 4:103578309-103578331 TAATATACAGTGGTGGAGAAAGG - Intergenic
978007078 4:103630071-103630093 CAAAAACAAGAAATGGAGAAAGG + Intronic
978114018 4:104997503-104997525 AAAAAACAAGCGATGGAGAAAGG - Intergenic
978150203 4:105425689-105425711 TAAACCCCACAGATTGAGAAAGG + Intronic
978747139 4:112207685-112207707 TTTAATTCAGAGAGGGAGAAGGG - Intergenic
979074335 4:116253167-116253189 CAAAAACAAGAAATGGAGAAAGG - Intergenic
979321062 4:119325528-119325550 CAAAAACAAGAAATGGAGAAAGG - Intergenic
979455693 4:120923039-120923061 GAAAACCCAGAGCTGGACAAAGG - Intergenic
979567057 4:122166333-122166355 CAAAATCAAGAAATGGGGAAAGG - Intronic
980332126 4:131423825-131423847 GAAAAACAAGAAATGGAGAAAGG + Intergenic
980336055 4:131474805-131474827 CAAAAACAAGAAATGGAGAAAGG - Intergenic
980663040 4:135892286-135892308 TAAAATCCAGAAATAAAGAATGG - Intergenic
981109846 4:140922851-140922873 CAAAAACCAGAAATGGGGAAAGG + Intronic
981152923 4:141399751-141399773 TAAAAACAAGAAATGGGGAAAGG - Intergenic
981234957 4:142405094-142405116 TCAAATCCAGAGATGGGGCGGGG + Intronic
981259819 4:142706287-142706309 TAAAATCCAGAAAGGGAGACAGG - Intronic
981267278 4:142801698-142801720 TAAAATTCAGTGATGGATATAGG + Intronic
981299983 4:143176161-143176183 CAAAAACAAGAAATGGAGAAAGG + Intergenic
981319321 4:143373437-143373459 TAAAATGCAGAAATGTAAAATGG - Intronic
981513121 4:145579207-145579229 CAAAAACAAGAAATGGAGAAAGG + Intergenic
981705801 4:147658042-147658064 AGAACTCCAGAGATGGAAAATGG - Intronic
981723846 4:147827707-147827729 TAAAAGCCACAGATTAAGAAAGG + Intronic
982314244 4:154015381-154015403 TAAAATCCAGAGAAGAAGGGTGG - Intergenic
982991343 4:162279670-162279692 TAAAATGTAGAGTTGAAGAAGGG + Intergenic
983597903 4:169491157-169491179 AAAAAAAGAGAGATGGAGAAAGG + Intronic
983828619 4:172297611-172297633 TAAAAACAAGAAATGGGGAAAGG - Intronic
984290020 4:177782828-177782850 TAAAAACAAGAAATGGGGAAAGG + Intronic
984315868 4:178130377-178130399 TAGAATGAAGACATGGAGAAGGG + Intergenic
984384242 4:179034797-179034819 CAAAAACCAGAAATGGGGAAAGG + Intergenic
985790361 5:1923696-1923718 TAAAATCCAGGGAAGGAAAGAGG - Intergenic
985832693 5:2246543-2246565 TAAAATAAAGATATGGAGATAGG - Intergenic
986240680 5:5957050-5957072 TGTAATGCAGAGATGAAGAAAGG + Intergenic
987249023 5:16079942-16079964 GAAAATCCAGAGATGGGAAGGGG - Intronic
988072221 5:26307304-26307326 CAAAAACAAGAAATGGAGAAAGG + Intergenic
989964734 5:50454247-50454269 GAAAAACAAGAAATGGAGAAAGG - Intergenic
990166042 5:52994252-52994274 AAAAATCCAAACATGGGGAAAGG + Intronic
990380105 5:55214509-55214531 TGAGATGCAGAGATGAAGAAGGG + Intergenic
990656427 5:57961811-57961833 TAAAATCAAGCAATGGGGAAAGG - Intergenic
990679059 5:58220760-58220782 TAAAAACAAGAAATGGGGAAAGG + Intergenic
990817876 5:59805953-59805975 TTAAATCAAGATTTGGAGAATGG - Intronic
990913408 5:60877139-60877161 CAAAAACAAGAAATGGAGAAAGG - Intronic
990924607 5:61006201-61006223 TAAAAACAAGAAATGGGGAAAGG - Intronic
990924710 5:61007376-61007398 CAAAAACAAGAGATGGGGAAAGG - Intronic
991271975 5:64795023-64795045 TCAAATCCAGAGTTATAGAAGGG + Intronic
991424977 5:66481457-66481479 CAAAAACAAGAAATGGAGAAAGG - Intergenic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992183287 5:74219323-74219345 CAAAAACCAGAAATGGGGAAAGG + Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992494530 5:77279963-77279985 TATAATCCAGAAATAGGGAAAGG - Intronic
992554194 5:77887201-77887223 TAAAATACAGACAAGGATAAAGG + Intergenic
992766214 5:80003095-80003117 TTAACTCCTGGGATGGAGAAAGG + Intronic
992814376 5:80421554-80421576 TAAAAACAAGAAATGGGGAAAGG - Intronic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
993483975 5:88459481-88459503 TAAAATGCAGAGAAGCACAAAGG - Intergenic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993527853 5:88988679-88988701 CAAAAACAAGAAATGGAGAAGGG - Intergenic
993854369 5:93055164-93055186 TAATAGATAGAGATGGAGAATGG - Intergenic
994232548 5:97324592-97324614 TAAAATCCAGAGGAGGAAAAGGG - Intergenic
994333782 5:98539835-98539857 TAAAAGAGAGAGATGGAGAGAGG + Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
996201480 5:120680224-120680246 TCAAATTCAGAGAAGGAGACAGG - Intronic
996359687 5:122632057-122632079 TAAAAACAAGAAATGGGGAAAGG - Intergenic
997300999 5:132805099-132805121 CAAAAACCAGAAATGGGGAAAGG + Intronic
997879818 5:137579587-137579609 TAGAGTCTAGACATGGAGAATGG + Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998635660 5:143952238-143952260 TAGATGCCAGACATGGAGAAAGG - Intergenic
998931418 5:147185637-147185659 TAAAAACAAGAAATGGGGAAAGG + Intergenic
999075480 5:148791443-148791465 TAAGAGTCAGAGATGGAAAAAGG - Intergenic
999213147 5:149907543-149907565 TCAAATCTAGACATGGAGAAAGG + Intronic
999214844 5:149923932-149923954 TATCATCCAGAGAAGCAGAAGGG + Intronic
999416717 5:151404270-151404292 CAAAGTAAAGAGATGGAGAAAGG - Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999598352 5:153232036-153232058 TAAAATCTAATGATGAAGAAGGG - Intergenic
1000230487 5:159311048-159311070 TTACATCCAGAGAAGGTGAAAGG + Intergenic
1000647624 5:163777897-163777919 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1000769595 5:165336268-165336290 TAAATTCCACAGATTGAGAATGG + Intergenic
1001298100 5:170513272-170513294 TAGAATCCAGAGAAGGTGAGTGG + Intronic
1003704122 6:8505438-8505460 TTAAAAGAAGAGATGGAGAATGG + Intergenic
1003746992 6:9013366-9013388 TAAAACCCAGTGATGGAGTGGGG + Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004508936 6:16268772-16268794 AAAGTTCCAGAGATGGATAATGG + Intronic
1004638851 6:17494597-17494619 TAAAAACCATAGAGGGAAAAAGG - Intronic
1005117010 6:22350209-22350231 TAAAGTCCAGAGCTGTAGCATGG + Intergenic
1005901134 6:30217188-30217210 TAAAATCCTGAGATTCTGAATGG - Intergenic
1006211419 6:32398608-32398630 TAAAATCCTCATATGGATAAAGG - Intronic
1006308530 6:33240444-33240466 GAAAATCTGGAGATGAAGAATGG + Intergenic
1007128905 6:39451030-39451052 TAAAATCCAGCATTAGAGAATGG - Intronic
1007434184 6:41796786-41796808 CAAAATCAGGAGATGAAGAAAGG + Intronic
1007574015 6:42913157-42913179 TAAATTCTAGAGATGGATGATGG + Intergenic
1007868682 6:45006737-45006759 AAAAGTTTAGAGATGGAGAAGGG - Intronic
1008246335 6:49178475-49178497 TAATCTCCAGTGATGGAGATGGG - Intergenic
1008317103 6:50058155-50058177 TTAAATGCAGAGATGTAGATGGG + Intergenic
1008349473 6:50473104-50473126 TAAAACCCAGAGAAAGAGAGGGG + Intergenic
1008798069 6:55330359-55330381 TACAATCCAGTGGTGGAGACAGG + Intronic
1008828597 6:55730441-55730463 TATATTCCAGAGGAGGAGAAAGG + Intergenic
1008928630 6:56913968-56913990 TAAAAACCAAAGCTGGAGATGGG - Intronic
1008978168 6:57453045-57453067 TAAAAACAAGAAATGGGGAAAGG - Intronic
1009166318 6:60346005-60346027 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1009193530 6:60657732-60657754 AAAAATCAAGAGTTGGAGTAGGG - Intergenic
1009239288 6:61164224-61164246 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1009314414 6:62199966-62199988 CAAAAACAAGAAATGGAGAAAGG + Intronic
1009384437 6:63071536-63071558 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1009704349 6:67226519-67226541 GAAAATTCAGAGTTGGAGAAGGG - Intergenic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1010034404 6:71307165-71307187 TAGAGTTCAGAGAGGGAGAAGGG + Exonic
1010130947 6:72492953-72492975 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1010334504 6:74664878-74664900 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1010339016 6:74725428-74725450 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1010614840 6:78000071-78000093 TAAAGTACAAACATGGAGAAAGG + Intergenic
1010903543 6:81457263-81457285 TAAAATAAAGAAATAGAGAAAGG + Intergenic
1011147838 6:84238377-84238399 CAAAATCAAGCGATGGGGAAAGG + Intergenic
1011264511 6:85501076-85501098 TAAACTCCACAGATGAAGTAAGG + Intergenic
1011308343 6:85954161-85954183 GAAAAACAAGAAATGGAGAAAGG - Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011407845 6:87034491-87034513 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1011987469 6:93466911-93466933 TGAAATCCAGTGATGGAAACTGG + Intergenic
1012018334 6:93881935-93881957 AAAAAACAAGAAATGGAGAAAGG - Intergenic
1012374008 6:98539015-98539037 AAAAATCCAGTAGTGGAGAAAGG + Intergenic
1012511652 6:100009679-100009701 TCACATCCATGGATGGAGAAAGG + Intergenic
1012624774 6:101392743-101392765 TAAAGGCCAGAGATGGGGAGGGG - Intergenic
1012643312 6:101649950-101649972 GAAGATCTAGAGATGGAAAAAGG - Intronic
1012810124 6:103946480-103946502 CAAAAACCAGCAATGGAGAATGG - Intergenic
1012931180 6:105318510-105318532 TGGTATCCAGAGAAGGAGAAAGG + Intronic
1013518248 6:110909161-110909183 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1013581741 6:111541880-111541902 TACAATCTAGAGGTGGATAAGGG + Intergenic
1014850692 6:126336682-126336704 TAAATTCCTGAGATGGTGCATGG + Intergenic
1015107966 6:129559048-129559070 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1015188808 6:130450249-130450271 GAAAAACCAGCGATGGAGACTGG - Intergenic
1016174370 6:141060976-141060998 TGAAATTCAGAGATGTATAATGG + Intergenic
1016492950 6:144627541-144627563 AAAATTCCAGAGATGGCTAATGG - Intronic
1016763629 6:147768010-147768032 TAAAATCAAGTAATGGTGAATGG - Intergenic
1017561688 6:155635082-155635104 GAAAATGCAGAAAAGGAGAAAGG + Intergenic
1017798089 6:157865597-157865619 GAAATTTCAGACATGGAGAAAGG + Intronic
1019845750 7:3499094-3499116 TAAAATCAAGAGTTGTAGAAAGG - Intronic
1020066372 7:5190955-5190977 GAAAATCAAGAGAGAGAGAAGGG - Intronic
1020335597 7:7059953-7059975 TAATATCCAGGGAGGGAGACAGG - Intergenic
1020352022 7:7230981-7231003 AAAAATTCAGAGATGTAGGAAGG - Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020609512 7:10377420-10377442 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1021456388 7:20833551-20833573 AAAATTATAGAGATGGAGAACGG + Intergenic
1021903533 7:25311180-25311202 AAAAGTCCAGAGAGGTAGAATGG - Intergenic
1021930374 7:25575213-25575235 TAATATCCAAAGATAGAGAGTGG - Intergenic
1023349046 7:39301039-39301061 AAAAATCCTGAGAAGAAGAAAGG - Intronic
1023501488 7:40854757-40854779 AAAAATCTAGAGATGGGGACTGG - Intronic
1024031422 7:45463685-45463707 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1024380439 7:48689809-48689831 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1024562579 7:50656735-50656757 GAGAATGCAGAGGTGGAGAAAGG + Intronic
1024671057 7:51595258-51595280 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1024745164 7:52398102-52398124 TAAAATAAAGGGATGGAAAAAGG - Intergenic
1024817061 7:53283619-53283641 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1025219185 7:57090983-57091005 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1026729152 7:72896113-72896135 TAAAACCCAAAGATTGACAACGG - Intronic
1026998257 7:74633656-74633678 TCAAATCCAGACCTGCAGAATGG - Intergenic
1027114854 7:75471001-75471023 TAAAACCCAAAGATTGACAACGG + Intronic
1027437860 7:78184092-78184114 TAAAAACAAGAGAAGGAGAATGG - Intronic
1027816696 7:82981955-82981977 TAAAAACCGGAGAAGAAGAAAGG - Intronic
1028379683 7:90185537-90185559 TAAAAACAAGAAATGGGGAAAGG + Intronic
1028836853 7:95384085-95384107 TAAAAACAAGAAATGGGGAAAGG + Intronic
1028963951 7:96780628-96780650 GAAAATCCAGACAGGCAGAAAGG + Intergenic
1029012323 7:97274677-97274699 TCAAGTGCAGAGAAGGAGAAGGG + Intergenic
1029887056 7:103884163-103884185 TAAAAACAAGAAATGGGGAAAGG + Intronic
1029928952 7:104350473-104350495 TATTAACCAGAGATGGATAAAGG + Intronic
1030586726 7:111429878-111429900 TCAAAATCAGAGATGGAAAAGGG + Intronic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1031302748 7:120083806-120083828 TTAAAACCAGTGATGAAGAAGGG - Intergenic
1031388873 7:121188626-121188648 TAACATTTAGAGATGGGGAAAGG + Intronic
1032311795 7:130794361-130794383 TAGAATACAGAGATGTAGGATGG - Intergenic
1032883020 7:136110162-136110184 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1033145040 7:138863971-138863993 GAAAATCAAGAATTGGAGAAGGG - Intronic
1033484094 7:141771216-141771238 CAAAAACAAGAAATGGAGAAAGG - Intronic
1035315706 7:157996775-157996797 TCAAATCCAGTGATAAAGAATGG + Intronic
1035348105 7:158221098-158221120 CAAAAACAAGAAATGGAGAAAGG + Intronic
1035693631 8:1576724-1576746 CAAAAACAAGAAATGGAGAAAGG - Intronic
1035773331 8:2167770-2167792 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1035993892 8:4523865-4523887 TAAAGACCAAAGAAGGAGAAAGG - Intronic
1036490627 8:9221913-9221935 TGAGATCCAGAGCTGGAGTAAGG - Intergenic
1037565969 8:20118835-20118857 TAATCTCCAAAGTTGGAGAAGGG + Intergenic
1037675737 8:21049509-21049531 TAGAAACTAGAGATGGAGGAAGG + Intergenic
1038421479 8:27436771-27436793 AAAAATCCAATGATAGAGAAAGG + Intronic
1039158323 8:34588309-34588331 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1039195181 8:35023286-35023308 TCTCTTCCAGAGATGGAGAAGGG + Intergenic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1039585318 8:38702291-38702313 TAAAATACAGATATGGTGAGAGG + Intergenic
1040085058 8:43331334-43331356 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1040606680 8:48940351-48940373 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1040765496 8:50905076-50905098 TAAAATCCAGTCATGGATATAGG + Intergenic
1040771882 8:50987743-50987765 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1040926739 8:52692603-52692625 TAAAATCCATAGCTGGATCACGG + Intronic
1041061320 8:54037525-54037547 TAAATTACAGAGATGGAAAATGG - Intergenic
1042408294 8:68431904-68431926 TAAAATCCAGAGATAAAGGTAGG - Intronic
1042412305 8:68479556-68479578 TAAATACCAGAGATGGAGGTTGG + Intronic
1042597106 8:70461482-70461504 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1042977984 8:74492200-74492222 TTTAACCCAGTGATGGAGAAGGG - Intergenic
1043378771 8:79680383-79680405 CAAAATCAAGAAATGGGGAAAGG + Intergenic
1043470033 8:80553122-80553144 TAACATCCATAAATAGAGAATGG + Intergenic
1043592936 8:81850912-81850934 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1043725566 8:83606299-83606321 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1043806728 8:84681110-84681132 CAAAATCAAGAAATGGGGAAAGG - Intronic
1043828018 8:84952685-84952707 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1043845275 8:85156152-85156174 CAAAAACCAGAAATGGGGAAAGG + Intergenic
1044038172 8:87332637-87332659 TAAAATCAAGCAATGGGGAAAGG - Intronic
1044048526 8:87469083-87469105 TAAAATAAAGAAATAGAGAAAGG + Intronic
1044074202 8:87798102-87798124 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1044200496 8:89429557-89429579 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1044313540 8:90724170-90724192 TAAAATCCAGAGAAGGAAACTGG + Intronic
1044349710 8:91149344-91149366 CAAAAACAAGAAATGGAGAAAGG - Intronic
1044388483 8:91619841-91619863 TGAAACCCAGAGATTCAGAAAGG - Intergenic
1045212964 8:100118122-100118144 CAAAAACAAGAAATGGAGAAAGG + Intronic
1045360713 8:101430601-101430623 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1045439739 8:102197680-102197702 CAAAGGCCAGAGATGGGGAATGG + Intergenic
1045676174 8:104610149-104610171 TAAAAGCAAGCAATGGAGAAAGG - Intronic
1045699848 8:104853131-104853153 TACAATCCAGTGGGGGAGAAAGG + Intronic
1046367557 8:113255860-113255882 TAAAATCAAGGGATGTAAAACGG - Intronic
1046664461 8:116985139-116985161 TAACATGCAGAAATGTAGAAAGG + Intronic
1046926840 8:119800403-119800425 TAAAAACAAGAAATGGGGAAAGG - Intronic
1047539531 8:125751224-125751246 CAAAATCCAGTAATGGAGTAGGG - Intergenic
1047865127 8:129015082-129015104 CAAAATCAAGCAATGGAGAAAGG - Intergenic
1048578564 8:135711953-135711975 TGAGATCCAGAGAAAGAGAAAGG + Intergenic
1050169938 9:2804793-2804815 TATAGTCCTGAGATGGGGAAGGG - Intronic
1050836611 9:10088726-10088748 TAACATCCAAAGATGTAGATAGG - Intronic
1050855099 9:10344288-10344310 CAAAAACAAGAAATGGAGAAAGG - Intronic
1050901224 9:10951375-10951397 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1051037555 9:12766892-12766914 AAAAAATCAGAGACGGAGAATGG + Intergenic
1051208832 9:14719838-14719860 GAAAATCTTTAGATGGAGAAAGG + Exonic
1051432819 9:16997887-16997909 TTAAATTAAGAGATGGAGTAAGG - Intergenic
1052104217 9:24492409-24492431 CAAAATCCAAAGATGGAGCGAGG + Intergenic
1052115022 9:24639987-24640009 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1052345290 9:27403236-27403258 TAAAATCCAGAGATATAAACTGG - Intronic
1052465394 9:28822862-28822884 TAAAATCCAGAGATGGCACTGGG + Intergenic
1052506731 9:29364439-29364461 TCAATTCCAGAGATTGAAAACGG + Intergenic
1052582415 9:30375238-30375260 TCATATCAAGAGATGCAGAAAGG + Intergenic
1052811770 9:33067380-33067402 TAAGAATCAGAGGTGGAGAAGGG + Intronic
1055601018 9:77918741-77918763 TACAATCCAGAAAGGGAGAAGGG - Intronic
1055989374 9:82089018-82089040 TAAAATACAAAGATTTAGAATGG - Intergenic
1056454062 9:86743540-86743562 TAAAGTTCAGATATGGAGAAGGG - Intergenic
1056833473 9:89934907-89934929 TTATGTCGAGAGATGGAGAAGGG - Intergenic
1057130457 9:92650948-92650970 TAAAAACCAGACTTGGAGTAAGG - Intronic
1057290724 9:93805362-93805384 TAAAAACAAGCAATGGAGAAAGG + Intergenic
1057296502 9:93847448-93847470 TAAGCTTCAGAGAGGGAGAAGGG - Intergenic
1057556549 9:96092904-96092926 AAAATTCCAGAGATTGTGAAGGG - Intergenic
1057693263 9:97306053-97306075 AAAAAGCCAGAGATAGGGAACGG - Intergenic
1057770557 9:97963832-97963854 AGAAATCCAGAGAGGCAGAAGGG - Intergenic
1058010416 9:99970717-99970739 TAATATGCAGTGATGAAGAAGGG - Intergenic
1058496878 9:105568023-105568045 TAAAAACAAGAAATGGGGAAAGG + Intronic
1058518055 9:105795167-105795189 TAATATCCAGCGGTGGAGAGGGG - Intergenic
1058805717 9:108589490-108589512 GAAAATGTAAAGATGGAGAAGGG + Intergenic
1058899586 9:109430642-109430664 TATAATCCAGTGAGGGAGACAGG + Intronic
1059198052 9:112389352-112389374 TAAGATATAGAGAAGGAGAAAGG + Intronic
1059400032 9:114063192-114063214 AAAAATCCAGAGAGAAAGAAGGG + Intronic
1059658104 9:116374763-116374785 CAAAATCCAGAGATGTTGGAGGG - Intronic
1060509312 9:124220667-124220689 TAAAATTCTGAGAAGGAGAGCGG - Intergenic
1060925555 9:127452850-127452872 TAAATACCAGAGCTGGATAAGGG - Intronic
1061164042 9:128912250-128912272 TAGAATCCAGCTATGGAGCAAGG + Intronic
1061622667 9:131821865-131821887 TCAAATCCATAGAGGCAGAATGG + Intergenic
1062705383 9:137936739-137936761 TAAAAACAAGAAATGGGGAAAGG - Intronic
1186122791 X:6381798-6381820 CAGAATCCAGAGATGTAGAAGGG - Intergenic
1186400700 X:9256822-9256844 TAAAATGCATAGATGGATGATGG + Intergenic
1186910271 X:14156695-14156717 TAAAAACAAGCAATGGAGAAAGG - Intergenic
1186954064 X:14660622-14660644 TCAAAGCGAGAGATGGAGATTGG + Intronic
1187681939 X:21776711-21776733 TGAAATTTAGAGATGGAAAATGG - Intergenic
1187726185 X:22204513-22204535 TACAATCTAGTGAGGGAGAAAGG - Intronic
1188063182 X:25625947-25625969 TAAAATCCAGCGTTTGAGAGAGG + Intergenic
1188296928 X:28461048-28461070 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1188851637 X:35139708-35139730 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1188861326 X:35260023-35260045 TAAGACACAGAGATGGAGAGTGG + Intergenic
1189190163 X:39094306-39094328 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1189432376 X:40959057-40959079 TAGAATGCTGAGAGGGAGAATGG - Intergenic
1191168779 X:57419978-57420000 GAAAAACCAGAAATGGGGAAAGG - Intronic
1191589093 X:62861003-62861025 CAAAAACAAGAGATGGGGAAAGG + Intergenic
1191770185 X:64747165-64747187 TAACATCCAGAGTTGGAGGTGGG - Intergenic
1191804498 X:65119906-65119928 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1191809095 X:65167302-65167324 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1191956329 X:66646090-66646112 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1192003794 X:67187719-67187741 CAAAAACAAGAAATGGAGAAAGG - Intergenic
1192128537 X:68525744-68525766 TAAAAACCAGCAATGGGGAAAGG - Intronic
1192244306 X:69360221-69360243 TGACCTCCAGATATGGAGAAAGG - Intergenic
1192382163 X:70628337-70628359 TATAAACAAGACATGGAGAAAGG - Intronic
1192475688 X:71440138-71440160 AAAACTATAGAGATGGAGAACGG - Intronic
1193429635 X:81385604-81385626 TAAAAACAAGCAATGGAGAAAGG - Intergenic
1193883274 X:86953168-86953190 TCAAATCCAGAGAAGTAGAGAGG + Intergenic
1194221180 X:91193453-91193475 AAAAATCAAGAAATGGGGAAAGG + Intergenic
1194628610 X:96255471-96255493 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1194632491 X:96302621-96302643 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1194648879 X:96491288-96491310 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1194863495 X:99035372-99035394 TAGAATCCAGAGATGGTGGTGGG + Intergenic
1194944057 X:100047435-100047457 TAAACTTCAGTGTTGGAGAAGGG + Intergenic
1194973357 X:100368462-100368484 TAAAGTCCATAAATGGTGAAAGG - Intronic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195556569 X:106233630-106233652 TCAAGTCCAGAGAAGGAGACTGG + Intergenic
1195665520 X:107426579-107426601 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1195677349 X:107517136-107517158 TAAAAACAAGAAATGGGGAAAGG - Intergenic
1195858536 X:109356494-109356516 TGAACTCCAAAGATGTAGAAAGG - Intergenic
1195867255 X:109446506-109446528 CAAAATCAAGAAATGGGGAAAGG + Intronic
1196500671 X:116377692-116377714 TAAAAACCAGAGATGTAGCCAGG + Intergenic
1196592616 X:117504829-117504851 TAAAAACAAGAAATGGGGAAAGG + Intergenic
1196675564 X:118417121-118417143 AAAGATACAGAGATGCAGAATGG - Intronic
1196712720 X:118780111-118780133 AAAATTCCAGATATGGGGAAGGG + Intronic
1197646478 X:129023357-129023379 AAAAATCAAGAAATGGGGAAAGG + Intergenic
1197868696 X:131045562-131045584 GAAAAACAAGACATGGAGAAAGG - Intergenic
1198029602 X:132742356-132742378 TGAAACCCAGAGATGGGCAATGG + Intronic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198044005 X:132881884-132881906 CAAAAACCAGAAATGGGGAAGGG - Intronic
1198168812 X:134084323-134084345 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1198887752 X:141357864-141357886 CAAAAACCAGAAATGGGGAAAGG - Intergenic
1199181173 X:144855530-144855552 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1199227280 X:145392704-145392726 TAAAATTCAGCTATAGAGAAAGG - Intergenic
1199333988 X:146597077-146597099 ATAAATTCAGAGATGGAAAAGGG - Intergenic
1199344508 X:146722844-146722866 CAAAAACAAGAAATGGAGAAAGG + Intergenic
1199668749 X:150123096-150123118 TAAAGTACAGAGGTGGAAAAAGG + Intergenic
1199789801 X:151142159-151142181 CAAAATCAAGAAATGGGGAAAGG - Intergenic
1200932259 Y:8707717-8707739 TAAAATCCCAAGATGATGAAAGG + Intergenic
1200959252 Y:8982107-8982129 TTTAAATCAGAGATGGAGAAGGG - Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic
1201312108 Y:12606480-12606502 TTTAAATCAGAGATGGAGAAGGG + Intergenic
1201474578 Y:14366603-14366625 CAGAATCCAGAGCTGTAGAAGGG + Intergenic
1201734347 Y:17241682-17241704 TTAAATCAATAGATGCAGAAAGG - Intergenic
1202591186 Y:26485174-26485196 CAAAAACAAGCGATGGAGAAAGG - Intergenic