ID: 1150753880

View in Genome Browser
Species Human (GRCh38)
Location 17:67892852-67892874
Sequence GTGGACTATCAGATAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150753880_1150753884 26 Left 1150753880 17:67892852-67892874 CCACTGTTTATCTGATAGTCCAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1150753884 17:67892901-67892923 ATACTATTTTGAAGTATCCATGG 0: 1
1: 0
2: 3
3: 24
4: 258
1150753880_1150753886 28 Left 1150753880 17:67892852-67892874 CCACTGTTTATCTGATAGTCCAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1150753886 17:67892903-67892925 ACTATTTTGAAGTATCCATGGGG 0: 2
1: 0
2: 2
3: 17
4: 236
1150753880_1150753885 27 Left 1150753880 17:67892852-67892874 CCACTGTTTATCTGATAGTCCAC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1150753885 17:67892902-67892924 TACTATTTTGAAGTATCCATGGG 0: 1
1: 0
2: 2
3: 15
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150753880 Original CRISPR GTGGACTATCAGATAAACAG TGG (reversed) Intronic
900373653 1:2343671-2343693 CTGGGCTCTCAGATAGACAGAGG + Intronic
902859374 1:19233972-19233994 GTGGAAAATAAGATAAGCAGAGG - Intronic
905048060 1:35024288-35024310 TTTGACTATCAAATAAACAATGG - Intronic
905853235 1:41289814-41289836 GTGGACTATGAGCTAAAGGGAGG + Intergenic
907040644 1:51256095-51256117 ATGAACTCTAAGATAAACAGTGG - Intronic
908312017 1:62893982-62894004 GAGGACTATCAGATTATTAGAGG + Intergenic
909314304 1:74196672-74196694 GTGGACTGTAAGAGAAAAAGAGG - Intronic
910500605 1:87886100-87886122 GAGGAACATAAGATAAACAGAGG - Intergenic
911234061 1:95391078-95391100 GTGGATTGTCACATAGACAGGGG + Intergenic
921083909 1:211769293-211769315 GTGGAATATGAGAGAAAAAGAGG + Intronic
1063175851 10:3550455-3550477 GTGGACAATAAGAGAAACCGTGG + Intergenic
1064800981 10:19071535-19071557 GAGGACTTTGAGATAAAGAGAGG - Intronic
1068672814 10:59741313-59741335 GTGGTATAAAAGATAAACAGTGG - Intergenic
1069043828 10:63722228-63722250 GTGAATTCTCAGATTAACAGAGG - Intergenic
1071903341 10:90144674-90144696 GAAGACTAGCAGACAAACAGTGG - Intergenic
1074432483 10:113405656-113405678 GTGCCCTCTCAGACAAACAGAGG + Intergenic
1075578926 10:123602006-123602028 GTAGATTAACAGATAAACAGTGG - Intergenic
1078395127 11:10974346-10974368 GTTGATTATCTGATTAACAGTGG - Intergenic
1079061449 11:17252368-17252390 GGGGACAATAAGAAAAACAGTGG + Intronic
1079087090 11:17454291-17454313 GTGGCCTCTCAGTTTAACAGAGG + Intronic
1080702456 11:34655592-34655614 GTGGAGGATCTGAGAAACAGAGG - Intronic
1083574323 11:63778604-63778626 TTGGACTATCAGAGAAAGAGAGG + Intergenic
1085522271 11:77145765-77145787 GTGGAGTATCAGGGAAACTGGGG + Intronic
1086558269 11:88137751-88137773 GTGGACTTTCAGATTACCAGGGG + Intronic
1091880055 12:3969745-3969767 GGGGAATGTCAGGTAAACAGAGG + Intergenic
1092801102 12:12167730-12167752 GTGCACTATCTGGTAAACACTGG + Intronic
1097347623 12:58511746-58511768 GTGCTCTCTCAGATACACAGAGG - Intergenic
1099133920 12:78869283-78869305 ATGGACTGTAAGATAAACTGTGG + Intronic
1099270883 12:80508856-80508878 GTGGAATACCAGATAAAGCGTGG - Intronic
1099276666 12:80585286-80585308 GTGAAATATCAGAGAAAGAGAGG - Intronic
1100814992 12:98378316-98378338 ATGGAGTATGAGATAAAGAGAGG - Intergenic
1101687151 12:107036291-107036313 GTGGACTATGAAAGAAAGAGAGG - Intronic
1102657232 12:114492256-114492278 GGGGACTTTCAGAGATACAGGGG - Intergenic
1102772431 12:115489898-115489920 GTGGACTCTCAGAAAAACCTGGG - Intergenic
1103862945 12:124028720-124028742 CTTGACAATCAGATGAACAGAGG + Intronic
1103932933 12:124460136-124460158 GTGGCCAGTAAGATAAACAGTGG - Intronic
1108556688 13:51600471-51600493 GTGGACTAAGAAAGAAACAGAGG - Intronic
1110982187 13:81915040-81915062 GTGGACAATAAAATAAACAGAGG - Intergenic
1112387217 13:98950976-98950998 CTTGACTTTCAGTTAAACAGAGG + Intronic
1113048666 13:106184555-106184577 GTTGAGCATCAGGTAAACAGTGG + Intergenic
1117359974 14:54963415-54963437 GTGCACTATGCAATAAACAGTGG + Intronic
1120712319 14:87805828-87805850 GGGTACTATCAGCTAAACGGTGG - Intergenic
1121708404 14:96018369-96018391 GTGGTCTACCAGATAGCCAGAGG - Intergenic
1124590522 15:31049540-31049562 GTGGCCTCTCAGAGACACAGGGG + Intronic
1125888481 15:43247973-43247995 GTGGGCTATGAGATAAAAGGGGG + Intronic
1127897352 15:63313764-63313786 TTGGACTATCAGATTATCAAGGG + Intergenic
1131982133 15:98004473-98004495 GTGGACTCACAGAGAAAGAGAGG - Intergenic
1132420552 15:101662886-101662908 CTGTGCTATCAGATAAACATTGG + Intronic
1135692384 16:24551481-24551503 GTGGACTATAAGATATTTAGGGG + Intronic
1138527792 16:57619093-57619115 GGGGACTATGGGAGAAACAGTGG + Intronic
1141902066 16:86997370-86997392 GTGGCCAAGCAGATAAAAAGAGG - Intergenic
1146422418 17:32700346-32700368 GCGGCCTATCAGATCAGCAGCGG - Intronic
1146825434 17:36018569-36018591 ATGGGGTATGAGATAAACAGAGG - Intergenic
1147952059 17:44112804-44112826 GTGGACCAGCAAAGAAACAGGGG + Intronic
1147968308 17:44206083-44206105 TTGGCCTCTCAGATGAACAGGGG + Exonic
1150753880 17:67892852-67892874 GTGGACTATCAGATAAACAGTGG - Intronic
1151073198 17:71240984-71241006 GTGGATTATAAAATAAACCGTGG - Intergenic
1158017846 18:52805892-52805914 GTGGACTTTCAAATAAAAAGAGG - Intronic
1158247300 18:55446395-55446417 GTGGAATAGCAGCTAAACATGGG - Intronic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
1160231256 18:77051374-77051396 GTGGATTTTAAAATAAACAGTGG - Intronic
1162831750 19:13289008-13289030 GTGCAGTCTCAGAGAAACAGTGG - Intronic
926379920 2:12276798-12276820 AAGGACTGTCAGATAAACTGTGG - Intergenic
927403946 2:22746843-22746865 GTGGACTATCTTCTAATCAGTGG - Intergenic
931789090 2:65647530-65647552 GTGAACAATCAGAATAACAGTGG + Intergenic
932364843 2:71143828-71143850 GTGGATAAGCAGATAAACTGTGG - Intronic
940653817 2:156464410-156464432 GTGGATTATTAGATGTACAGAGG + Intronic
941804580 2:169697604-169697626 GTGCACTTTCAGATCAGCAGGGG + Intronic
945876161 2:215280084-215280106 GTGGAGTAACAGATGAACAAAGG - Intergenic
947923480 2:233900272-233900294 GTGGAGTGTCAGATAAACTGTGG + Intergenic
1179409922 21:41154518-41154540 GTGGACTATCAAAGAGGCAGAGG + Intergenic
1181866985 22:25866314-25866336 TTGGACTCTCAGATAAACCCAGG - Intronic
949245093 3:1917841-1917863 GAAGCCTATCAGATTAACAGTGG - Intergenic
949778500 3:7658702-7658724 GTGGACTATTCTATAAACAATGG - Intronic
951515603 3:23555624-23555646 GTGGACAAATAGATAAACTGTGG + Intronic
952018034 3:28982693-28982715 GTGGACTCTCAGATAATAAGTGG - Intergenic
952350957 3:32537538-32537560 GAGAATTATCAGATAAACACAGG - Intronic
953178888 3:40578588-40578610 GTGGACTGTCAGTTTAACAAGGG - Intergenic
956362328 3:68461792-68461814 GTGGAGTATCAGAAAATCAGTGG - Intronic
957840717 3:85665659-85665681 GTGGACTACCAGAAAGACAAAGG - Intronic
963850158 3:150203028-150203050 CTGGACTGCCAAATAAACAGGGG - Intergenic
963904117 3:150759876-150759898 GTGGTCTTTCAGGCAAACAGTGG + Intronic
980748095 4:137047941-137047963 GTGGACAATCAGATAAATGAGGG + Intergenic
982303856 4:153907960-153907982 GTGAACTCTCCGATAAACATGGG - Intergenic
982463433 4:155700682-155700704 GTGGACTTTCTGATTCACAGAGG - Intronic
982617984 4:157666064-157666086 AAGGACTATCAGAAAGACAGAGG - Intergenic
983741835 4:171144035-171144057 GTGGACTATGTGATAAATGGTGG - Intergenic
984713954 4:182909319-182909341 GTGGGGTTTCAGATAAACAGAGG - Intronic
985140349 4:186833134-186833156 GTGGATCATCAGATAAAGACGGG + Intergenic
989412677 5:41138530-41138552 CTTGACTAGCAGATAAAGAGAGG + Intergenic
989511310 5:42290552-42290574 CTGGACTATGAGATAATAAGAGG + Intergenic
989548937 5:42709583-42709605 GTGCAATATCAGGTATACAGTGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
994518435 5:100798887-100798909 GTGAACTAAGAGATAAACAATGG - Intergenic
995922857 5:117334402-117334424 GTGTCCTATCAGATCAACAGTGG - Intergenic
996945555 5:129063097-129063119 GTGGGTTATCAGATCAACTGTGG - Intergenic
1000266028 5:159639004-159639026 ATAGAATATCAGATGAACAGTGG + Intergenic
1002462579 5:179382669-179382691 GTGTACTATGAAATACACAGGGG - Intergenic
1004311535 6:14550217-14550239 ATGGACTACCAGATACAAAGGGG + Intergenic
1005511469 6:26515831-26515853 GTGGAAAATGAGATAAAAAGAGG - Intergenic
1006194275 6:32228538-32228560 GTGGAGTATGAGAAAAAGAGAGG - Intergenic
1009570367 6:65376150-65376172 GTAGCCCATCAGATTAACAGTGG + Intronic
1010696470 6:78980458-78980480 GTGGAATATGAGAGAAAAAGAGG + Intronic
1011424904 6:87216331-87216353 TTGAGTTATCAGATAAACAGTGG + Exonic
1011456329 6:87553984-87554006 CTGGACAATCAGAGAAAGAGCGG - Intronic
1017746783 6:157454144-157454166 CTGGACTATGAGATAACCAAAGG - Intronic
1019115569 6:169758866-169758888 GTTGACTCTCAGTTAAAAAGAGG + Intronic
1022267369 7:28770524-28770546 GTGGACTAACAGATAAAAAATGG - Intronic
1024764045 7:52635035-52635057 CTGGACTATGAGATAACAAGTGG - Intergenic
1026561335 7:71452747-71452769 GTGCAGTATCTGATAAAAAGGGG + Intronic
1027555238 7:79655968-79655990 CTGGACTATCACATATACACTGG + Intergenic
1031026908 7:116689478-116689500 TTTGAATTTCAGATAAACAGTGG - Intronic
1031884469 7:127231516-127231538 TAGGACAATCAGAAAAACAGTGG - Intronic
1037486352 8:19351007-19351029 GTAGACTAACAGACAAAAAGCGG - Intronic
1037812097 8:22092838-22092860 GTGACCTCTCAGAAAAACAGGGG - Intronic
1043207942 8:77471183-77471205 GTGGAATATAAGATAAAAAGAGG + Intergenic
1043348360 8:79327101-79327123 GCGGGCTATCAGATGGACAGAGG - Intergenic
1046108565 8:109693788-109693810 GTGGACTAGAAGATAGAAAGAGG + Intergenic
1046895326 8:119465284-119465306 GAGGCCCATCAGACAAACAGTGG + Intergenic
1047775241 8:128065029-128065051 TTTTACTATCAGAGAAACAGAGG + Intergenic
1048870177 8:138790805-138790827 GTGCCCTATCAGTTATACAGTGG + Intronic
1049676532 8:143891712-143891734 GTGGACTTTCACATGAACAAGGG + Intergenic
1058305654 9:103437959-103437981 GAAGACCATCAGACAAACAGTGG - Intergenic
1186672594 X:11782164-11782186 GATGACTCCCAGATAAACAGAGG + Intergenic
1186969504 X:14825152-14825174 ATGGAAAATCAGATAAACAAAGG - Intergenic
1188933391 X:36143317-36143339 GTGGACTAGCAGATCACCAGTGG + Intronic
1190782720 X:53613870-53613892 GTGGAATATCAAATCAACAAAGG + Intronic
1192831656 X:74756562-74756584 GTGGAATATCAGAAAAGAAGAGG + Intronic
1193898464 X:87144596-87144618 GTGGACTCACATAGAAACAGTGG - Intergenic
1194755332 X:97732384-97732406 GTGTACTAACAGATCAACTGTGG + Intergenic
1195122290 X:101767456-101767478 TTGGAATTTCAGATAAACAATGG - Intergenic
1196772143 X:119305129-119305151 GAGGACTACCAGAGATACAGAGG - Intergenic
1198044939 X:132892271-132892293 GTGCACTATCAGAAATACAAGGG - Intronic
1199780077 X:151050443-151050465 GTGGAGTATAAGATAGAGAGAGG - Intergenic