ID: 1150757464

View in Genome Browser
Species Human (GRCh38)
Location 17:67928171-67928193
Sequence ACCGCAGCCAGCCATAAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 113}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150757457_1150757464 16 Left 1150757457 17:67928132-67928154 CCTCAGCCTCCCAGAGTGCTAGG 0: 207
1: 10055
2: 107920
3: 225496
4: 243772
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757459_1150757464 10 Left 1150757459 17:67928138-67928160 CCTCCCAGAGTGCTAGGATTACA 0: 658
1: 31076
2: 324240
3: 254433
4: 137894
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757456_1150757464 19 Left 1150757456 17:67928129-67928151 CCACCTCAGCCTCCCAGAGTGCT 0: 1461
1: 65016
2: 152147
3: 155962
4: 112468
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757462_1150757464 6 Left 1150757462 17:67928142-67928164 CCAGAGTGCTAGGATTACAGGTG 0: 175
1: 8646
2: 91962
3: 225825
4: 253581
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757455_1150757464 20 Left 1150757455 17:67928128-67928150 CCCACCTCAGCCTCCCAGAGTGC 0: 826
1: 35091
2: 140270
3: 237462
4: 236373
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757454_1150757464 23 Left 1150757454 17:67928125-67928147 CCACCCACCTCAGCCTCCCAGAG 0: 661
1: 26123
2: 81922
3: 166241
4: 179596
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113
1150757461_1150757464 7 Left 1150757461 17:67928141-67928163 CCCAGAGTGCTAGGATTACAGGT 0: 179
1: 9273
2: 106054
3: 323744
4: 231771
Right 1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG 0: 1
1: 0
2: 2
3: 14
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150757464 Original CRISPR ACCGCAGCCAGCCATAAATA CGG Intronic
906291059 1:44619398-44619420 ACCGAGGCCGGCCTTAAATAAGG - Intronic
906895741 1:49769134-49769156 ACCACACCCAGCCAAAAATCAGG + Intronic
908072600 1:60479012-60479034 ACCGCACCCAACCATAGATAAGG + Intergenic
908379513 1:63582892-63582914 ACCGCACCCAGCCATGCAAAAGG + Intronic
909249988 1:73341464-73341486 ACTGCATCCAGCCTAAAATAAGG + Intergenic
909716543 1:78714619-78714641 TCCACAGCCAGCCTTAAAAAGGG + Intergenic
910316297 1:85887570-85887592 AAAGCAGCCATCCATACATAAGG + Intronic
911702155 1:100966292-100966314 ACCGCACCCAGCCAAAAATGTGG - Intronic
914259174 1:145984622-145984644 ACCGCACCCAGCCGGAAATATGG + Intergenic
915420297 1:155775746-155775768 ACCGCACCCAGCCAAGAATTAGG + Intronic
919066627 1:192699125-192699147 ACCGCATCCAGCCAAAGACAAGG + Intergenic
919687903 1:200501554-200501576 ACCGCACCCAGCCAGATAAATGG - Intergenic
924502399 1:244650018-244650040 ACTGCAGCCAGGACTAAATAAGG + Intergenic
1065393631 10:25210842-25210864 ACCGCACCCAGCCAAAATTCTGG - Intronic
1065549385 10:26855679-26855701 ACCGCACCCGGCCCTAAACAGGG - Intronic
1065558275 10:26937645-26937667 CCAGCAGCCAGCAATAAATGAGG - Intergenic
1068246921 10:54384121-54384143 ACTGCATCCAGCCAAAAATATGG + Intronic
1070267154 10:74914799-74914821 ACCGCACCCAGCCAAAAAGCTGG - Intronic
1073163466 10:101421805-101421827 ATAGTAGCCAGCCATAAAAAAGG - Intronic
1076308048 10:129478668-129478690 GCCACAGCCAGCCAGAAGTAGGG - Intronic
1078820354 11:14873896-14873918 ACCACACCCAGCCAAGAATAAGG - Intergenic
1090198666 11:124838967-124838989 ACAGCAGCCAGAGAAAAATATGG - Intergenic
1095899923 12:47317584-47317606 ACCGCACCCAGCCAGAAAGAAGG + Intergenic
1097214859 12:57402844-57402866 ACTGCAGCCAGCCAAAAATAAGG + Intronic
1101109351 12:101470856-101470878 ACCGCACCCAGCCAAACATGAGG + Intergenic
1106500882 13:30327725-30327747 ACCGCGCCCAGCCACAAACACGG - Intergenic
1108060623 13:46529495-46529517 ATTTCAGCCAGCAATAAATAAGG + Intergenic
1110956492 13:81559151-81559173 TATGCAGCCAGCCATAAAAAAGG - Intergenic
1116234961 14:42268261-42268283 TTTGCAGCCAGCCTTAAATATGG - Intergenic
1118727038 14:68636291-68636313 ACCACGCCCAGCCTTAAATATGG - Intronic
1120784512 14:88520124-88520146 ACCACACCCAGCCAAAGATAAGG - Intronic
1126881807 15:53106916-53106938 ACAGCAGCCTTCCATAACTAAGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1128811043 15:70573013-70573035 TCGGCGGCCAGCCATAAAAAGGG - Intergenic
1129049136 15:72763473-72763495 ACCATACCCAGCCAAAAATATGG + Intronic
1131393282 15:92066798-92066820 ACCACTGCCAGCCATAGAGAGGG - Intronic
1132813966 16:1817243-1817265 CCCGCAGCCAGCCACAAACAAGG + Exonic
1133278745 16:4653145-4653167 TCAGCAACCAGCCATAAATCAGG + Intronic
1137612584 16:49828858-49828880 TCCTCAGCCTGCCAAAAATACGG - Intronic
1138283252 16:55788408-55788430 ACCGCACCCAGCCAATAATGTGG + Intergenic
1138373850 16:56548958-56548980 ACCGCACCCAGCCATGCATGTGG + Intergenic
1139342757 16:66279456-66279478 AACTCAGCCAGACAAAAATAAGG + Intergenic
1139374162 16:66486542-66486564 ACCGCACCCAGCCAGGATTACGG + Intronic
1140231590 16:73121902-73121924 ACCGCACCCAGCCATAATTGTGG + Intergenic
1140752683 16:78040154-78040176 ACCACACCCAGGCAGAAATAGGG + Intronic
1142404345 16:89878928-89878950 ACCGCGCCCAGCCAGTAATAAGG + Intronic
1143302809 17:5923312-5923334 ACCGCGCCCAGCCACATATAAGG + Intronic
1143968527 17:10774948-10774970 ACCGCACCCAGCCAAAACTTGGG - Intergenic
1147920255 17:43911962-43911984 ACAGCAGACAGCCAGAGATAAGG - Intergenic
1150342834 17:64382745-64382767 ACCACGCCCAGCCTTAAATATGG - Intronic
1150652186 17:67017364-67017386 ACTGCATCCGGCCATAACTATGG + Intronic
1150757464 17:67928171-67928193 ACCGCAGCCAGCCATAAATACGG + Intronic
1153052471 18:912678-912700 ACCACACCCAGCCTAAAATAGGG + Intergenic
1153118189 18:1686691-1686713 TCTGCAGCCAGCCTTAAACATGG - Intergenic
1154073581 18:11177828-11177850 ACCACAGCCAGGCAGAAATCAGG - Intergenic
1156306066 18:35879172-35879194 AGGGAAGCCATCCATAAATAAGG + Intergenic
1158181777 18:54724432-54724454 ACGGCACCCAGCCAGTAATACGG - Intronic
1159010114 18:63050969-63050991 ACTGCACCCAGCCTAAAATATGG + Intergenic
1160693153 19:469398-469420 ACCGCACCCAGCCATGATCAAGG - Intronic
1161543156 19:4864604-4864626 ACCGCACCCAGCCAAAATTTAGG + Intronic
1161860335 19:6793043-6793065 ACCGCGCCCGGCCATATATATGG - Intronic
1163994387 19:21029617-21029639 AGCGGGGCCAGACATAAATAAGG - Intronic
925178983 2:1804409-1804431 ACCGCGCCCAGCCACAACTAGGG + Intronic
929145436 2:38703393-38703415 ACCGCACCCAGCCTTAAACACGG + Intronic
931312814 2:61098391-61098413 ACCACACCCAGCCTTATATATGG + Intronic
934497895 2:94825533-94825555 ACCGCGCCCAGCCATATATGGGG + Intergenic
936482714 2:112900028-112900050 ACTGCAGCCAGCCAAAAACAAGG - Intergenic
943054904 2:182965099-182965121 ACCACACCCAGCCATAATAATGG - Intronic
946564151 2:220944479-220944501 AGCACAGCCAGCCAGAAAGAGGG + Intergenic
948210114 2:236186749-236186771 ATCACAGCCATCCATAAATCAGG + Intergenic
1170384933 20:15805763-15805785 ACCGCATCTGGCCAAAAATACGG + Intronic
1182973661 22:34601712-34601734 ACCGCACCCAGCCCTCACTATGG + Intergenic
951557010 3:23930968-23930990 ACCACAGCCAGCCAAAATAAAGG + Intronic
953444335 3:42949844-42949866 ACCGCACCCAGCCTTAAATAAGG + Intronic
953648698 3:44779543-44779565 ACCGTGCCCAGCCACAAATAGGG - Intronic
954457814 3:50609478-50609500 ACCCCAGCCATCCAAGAATATGG - Intronic
956275315 3:67493929-67493951 AAGGCAGCCAGCCATAAGGAAGG - Intronic
957479429 3:80772451-80772473 ACCGCACCCGGCCTAAAATAAGG - Intergenic
963122787 3:141790285-141790307 ACCGCACCCAGCCAGCATTATGG + Intronic
963369635 3:144382389-144382411 ACCGCACCCAGCCAGGATTAGGG - Intergenic
964282844 3:155085818-155085840 ACCGCACCCAGCCTTAAATTTGG + Intronic
965175830 3:165330714-165330736 ACTGCACCCAGCCAGATATATGG + Intergenic
965534378 3:169810109-169810131 ACCACACCCAGCTATAAAGACGG + Intronic
965823228 3:172705705-172705727 ACCGTGCCCAGCCAAAAATAGGG - Intronic
966810623 3:183840861-183840883 ACCACATCCAGCCATGAAAATGG + Intronic
968202492 3:196767166-196767188 AACTCAAACAGCCATAAATAGGG - Intronic
969879859 4:10163974-10163996 AGTGCAGCCAGCCAGGAATAAGG + Intergenic
974038645 4:56839202-56839224 ACCGCACCCAGCCAGAGATGAGG - Intergenic
974514669 4:62894489-62894511 ACCGCAACCAGCCAAAATTGAGG - Intergenic
977338201 4:95724549-95724571 ACCTCAGCCATCCAGAAGTAGGG + Intergenic
978668150 4:111211656-111211678 ACAGCAGCAAGCCAACAATATGG - Intergenic
982168112 4:152633911-152633933 ACCTCAGCCACCCAAACATAAGG - Intronic
985227643 4:187780174-187780196 ACCTTTGCCAGCCACAAATAGGG + Intergenic
989168572 5:38453663-38453685 AAGGCAGCCAGCCTGAAATAGGG - Intronic
989766041 5:45084734-45084756 ACCACATGCAGCCATAAAAAAGG - Intergenic
992718834 5:79539510-79539532 ACTGCACCCAGCCAATAATAGGG - Intergenic
994558263 5:101331964-101331986 AACCCAGCCAGACAGAAATAAGG + Intergenic
997938363 5:138134531-138134553 ACCGCACCCAGCCCTAATTTTGG + Intronic
998246858 5:140514679-140514701 ACCGCTCCCAGCCGTAAATTGGG - Intronic
999939837 5:156530419-156530441 ACTGAAGTCAGCCATAAATACGG - Intronic
1001907661 5:175486471-175486493 CCTGCACCCAGCCAAAAATATGG - Intronic
1002152204 5:177243485-177243507 ACTGCACCCAGCCATGAAGATGG + Intronic
1002849761 6:983346-983368 ACCGTGCCCAGCCATAAACATGG - Intergenic
1004226636 6:13790740-13790762 ACCGCACCCAGCCAACAATCTGG + Exonic
1011159181 6:84369171-84369193 ACCCCAGTCAGACATAAATTTGG + Intergenic
1011162497 6:84407273-84407295 ACAGCAGCCAGCCAGAACCAAGG + Intergenic
1020713211 7:11635582-11635604 ACAGCAACCAGCCAAAAATAAGG - Intronic
1022209968 7:28198895-28198917 ACCGCGCCCGGCCTTAAATAAGG + Intergenic
1022522142 7:31015279-31015301 ACCCCTGCCAGCCATAGATTAGG + Intergenic
1022842695 7:34179881-34179903 ACCGCACCCAGCCAAAAGCAAGG - Intergenic
1029415048 7:100437128-100437150 ACCGCACCTGGCCATAAATGGGG + Intergenic
1031046474 7:116894072-116894094 ACCGCACCCAGCCATCAGTCAGG - Intronic
1034623286 7:152472722-152472744 ACCGCACCCAGCCAAAAAAGAGG - Intergenic
1037225136 8:16578405-16578427 ACCACAGCCTGGCATAAATTAGG + Intergenic
1044640604 8:94377244-94377266 ACCGCATCCAGCCAGAAAAATGG - Intronic
1044988344 8:97774498-97774520 ACCGCACCCACCCTTAAACATGG - Intergenic
1045028283 8:98110547-98110569 ACCACACCCAGCCATTAAAATGG + Intronic
1048910054 8:139126586-139126608 ACAAATGCCAGCCATAAATATGG - Intergenic
1050593461 9:7183232-7183254 ACCGCATCCACCTTTAAATACGG + Intergenic
1052404164 9:28038402-28038424 ACCGCGCCCAGCCATAAGCAAGG - Intronic
1053298568 9:36932864-36932886 ACCGTGCCCAGCCATAATTACGG - Intronic
1058595463 9:106610776-106610798 TATGCAGCCAGCCATAAAAAAGG + Intergenic
1059714429 9:116900419-116900441 ACTCCAGGCAGCCATAAATGTGG - Intronic
1060406184 9:123374180-123374202 ACCCCAACCAGCCACCAATAGGG - Intronic
1061549200 9:131323483-131323505 ACCGCACCCAGCCAGAGACAGGG + Intergenic
1186473398 X:9838347-9838369 ACCGCACCCGGCCTTAAATCAGG + Intronic
1188572499 X:31605045-31605067 AACCCCACCAGCCATAAATAAGG + Intronic
1195489336 X:105449293-105449315 ACCGCACCCAGCCATACATCTGG - Intronic
1199645490 X:149906392-149906414 GCTGCAACCAGCCATAAAAAAGG + Intergenic
1199760278 X:150899233-150899255 ACCGCAGCCAGTCACGAAAACGG - Intergenic