ID: 1150759193

View in Genome Browser
Species Human (GRCh38)
Location 17:67944961-67944983
Sequence GCTCCATTTGGACACGCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150759193 Original CRISPR GCTCCATTTGGACACGCTTA GGG (reversed) Intronic
901534365 1:9872760-9872782 GCTGCATGTGGACACGCTGCTGG - Intronic
901811153 1:11767329-11767351 TCTCCATTTGGACAGGCAAATGG - Intronic
904985820 1:34547583-34547605 GCTCCATGTGTGCAGGCTTATGG - Intergenic
915841976 1:159220982-159221004 GCTCCATTTGAACAGGGTCAGGG + Intergenic
916392614 1:164347083-164347105 GCTTTATTTGTACACACTTAGGG - Intergenic
916678074 1:167081055-167081077 TCTCCATATGGACCCCCTTAGGG - Intronic
918914187 1:190614158-190614180 GTTGCATTTTGACACCCTTAGGG - Intergenic
920062636 1:203238270-203238292 GCTCCAGTTGGTGACACTTAAGG - Intronic
1078064154 11:8066969-8066991 GCTCCATCTGTACACGGTGATGG - Intronic
1086659156 11:89393131-89393153 GCTACATTTGGAGACACTTTTGG + Intronic
1088059806 11:105633817-105633839 GCTCCATTAGGATAGGCTAATGG - Intronic
1088921873 11:114265333-114265355 GCTCCTTTTGGAAACACTTCTGG + Intronic
1106125355 13:26896398-26896420 TCTCCATTTGGAGACTCTTCAGG - Intergenic
1108496042 13:51026310-51026332 TCTCCATTTGGACACATTTCTGG - Intergenic
1114519279 14:23322606-23322628 CCTCCAATTGGAGACGCTTTAGG + Intronic
1121640931 14:95484367-95484389 GCTCCAATTGGACACTTTGAAGG + Intergenic
1126147394 15:45488896-45488918 GCTGCATTTGTACATGCTTTGGG - Exonic
1127053027 15:55104467-55104489 GCTTCATTTTGGCACGATTAAGG + Intergenic
1133935893 16:10268859-10268881 GGACCATTTGGACACTCTAATGG + Intergenic
1134331780 16:13258150-13258172 ACTCCATTTGGACACAGTAAAGG + Intergenic
1134359392 16:13517265-13517287 GTTCCTTTTGGACCCGCTGAAGG - Intergenic
1134901901 16:17945876-17945898 CCTTCATTTGGACAAGCGTAGGG - Intergenic
1135170535 16:20179454-20179476 ACTTTATTTGGACACCCTTATGG + Intergenic
1135915838 16:26604755-26604777 GCTACATTGGGAGACTCTTAAGG + Intergenic
1142667152 17:1469714-1469736 CCTCCATCTGGAGACGCTTCCGG + Intronic
1144238580 17:13287037-13287059 GCTCCATGTGCACACACTAATGG - Intergenic
1150759193 17:67944961-67944983 GCTCCATTTGGACACGCTTAGGG - Intronic
1151073219 17:71241248-71241270 GCTCTATTTGGACAAACTTATGG + Intergenic
1153757140 18:8295479-8295501 GCACCATTTGGGAACGCTTTGGG - Intronic
1157545917 18:48546397-48546419 GCCCCTTTTGGACGTGCTTATGG - Intronic
933582934 2:84147782-84147804 GCTGCATTGGGACACTCTGATGG - Intergenic
939832886 2:147093979-147094001 GCACCATGTGGACACGTTAAAGG - Intergenic
944112981 2:196154356-196154378 GCTAAATTTGAACATGCTTAAGG - Intronic
946147407 2:217741407-217741429 GGTCCATTTGGAGACGCGAATGG - Intronic
955274965 3:57538511-57538533 TCTCCACTTTGACATGCTTAAGG - Intronic
955686823 3:61557660-61557682 GCTCCATTTGGTCAGGACTAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
967132007 3:186479192-186479214 GCTCTATTCTGACAGGCTTAGGG + Intergenic
969064115 4:4464224-4464246 GCTCCATTTGCACTGGCTTTAGG - Intronic
975172598 4:71249547-71249569 GCTGCTTATGGACACTCTTATGG + Intronic
976443481 4:85103994-85104016 GCTCCATATGGACACACGGAGGG + Intergenic
979419607 4:120487677-120487699 TCTCAATTTGCACACGCTCAGGG - Intergenic
986403781 5:7405652-7405674 GCTCCATTTGGCCAATCTAATGG - Intronic
998565040 5:143209448-143209470 GCACTATTTGGACACCCTTTAGG + Intronic
1000073988 5:157767729-157767751 CCTCCATTTGGCCACCCTCAAGG - Intergenic
1009468006 6:63997383-63997405 GCTCAATTTGGTCACGCTTGTGG - Intronic
1039451615 8:37679520-37679542 GCTCCACATGGACACACTGAGGG + Intergenic
1053484673 9:38442778-38442800 GCTCCATTTGGGCACTGTCAGGG - Intergenic
1056411678 9:86334400-86334422 GCTCAGTTTGGACAAGCTTGAGG - Intronic
1061505498 9:131029606-131029628 GCTCCCTCTGGACACATTTAGGG + Intronic
1189532545 X:41901649-41901671 GGTCCATTAGGACAGGCCTACGG + Intronic
1189695131 X:43655288-43655310 GCTCCATTCGGACAGGCTGTAGG - Intronic
1198693885 X:139314860-139314882 GCTCCATATTGACATGCTCAGGG - Intergenic
1198954457 X:142112482-142112504 GCTCCATTTGAGCAAGCTTTGGG + Intergenic