ID: 1150762863

View in Genome Browser
Species Human (GRCh38)
Location 17:67978260-67978282
Sequence GGGGCTGTGAACCACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150762854_1150762863 4 Left 1150762854 17:67978233-67978255 CCACCAGCCTTGGCCTCCCAAAG 0: 1208
1: 46440
2: 137346
3: 175482
4: 140868
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762850_1150762863 24 Left 1150762850 17:67978213-67978235 CCTGAGCTCAAGCGATCCTCCCA 0: 344
1: 5947
2: 32885
3: 84211
4: 162127
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762853_1150762863 5 Left 1150762853 17:67978232-67978254 CCCACCAGCCTTGGCCTCCCAAA 0: 19
1: 666
2: 2720
3: 5318
4: 6594
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762855_1150762863 1 Left 1150762855 17:67978236-67978258 CCAGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762860_1150762863 -9 Left 1150762860 17:67978246-67978268 CCTCCCAAAGTGCTGGGGCTGTG 0: 1
1: 19
2: 265
3: 4454
4: 50925
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762852_1150762863 8 Left 1150762852 17:67978229-67978251 CCTCCCACCAGCCTTGGCCTCCC 0: 2
1: 23
2: 317
3: 2195
4: 3497
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235
1150762857_1150762863 -3 Left 1150762857 17:67978240-67978262 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG 0: 1
1: 0
2: 4
3: 28
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150762863 Original CRISPR GGGGCTGTGAACCACTGTGC TGG Intronic
900656173 1:3758871-3758893 GCAGGTGTGAACCACTGTACTGG + Intronic
901631158 1:10648862-10648884 GGGGCTCTGAGCCCCTGTCCAGG - Intronic
902694008 1:18128240-18128262 CTGGCTGTGAACCTCTGTGAGGG + Intronic
903442910 1:23401750-23401772 GGGGGTGGGAACCCCTGTGTTGG - Intronic
906481096 1:46199217-46199239 TGGGCAGTGAGCCACCGTGCTGG + Intronic
907515667 1:54991838-54991860 GGGGATGTCAACCACTTTGGGGG - Exonic
908055352 1:60280361-60280383 GGGGCTGTGTTGCACAGTGCTGG - Intergenic
909858354 1:80571128-80571150 GTGGCTGTGAACCCATGTGAAGG - Intergenic
911040469 1:93587300-93587322 ACAGCTGTGAGCCACTGTGCTGG + Intronic
911161411 1:94686032-94686054 GGTGCTGGGAACCACTCTTCTGG + Intergenic
915090974 1:153425955-153425977 AGAGGTGTGAACCACTGTGCAGG - Intergenic
915596115 1:156897450-156897472 GGGGCTGTGAACCCCTGGGTTGG + Intronic
915803462 1:158819074-158819096 GTGGCTGTGAATCATTGAGCTGG - Intergenic
918211316 1:182353603-182353625 GGGGCTGAGCAGCACTGTGAAGG - Intergenic
919598979 1:199599665-199599687 GGGGTTGGGATCCACTGAGCTGG - Intergenic
923391333 1:233516073-233516095 GGTGCTGTGAACCATAGTGGAGG + Intergenic
924531850 1:244900271-244900293 GCAGGTGTGAGCCACTGTGCCGG - Intergenic
1062945343 10:1457034-1457056 ACAGGTGTGAACCACTGTGCTGG + Intronic
1063741950 10:8832793-8832815 GGTGATGTGAACCACAGAGCAGG - Intergenic
1064110672 10:12535959-12535981 GTGGCTGTTAACTGCTGTGCTGG + Intronic
1065705470 10:28468229-28468251 ACAGGTGTGAACCACTGTGCTGG - Intergenic
1065773625 10:29100160-29100182 GCAGGTGTGAACCACAGTGCTGG + Intergenic
1067298910 10:44992203-44992225 GGGGCTGTGTCCCACTGTTTTGG - Intronic
1069641814 10:69961274-69961296 GGGGCTGCAACCCACTGGGCAGG - Intronic
1070311513 10:75276724-75276746 GGGGCTGGGAGCAACTGTGCTGG + Intergenic
1070508732 10:77140436-77140458 GGGTCTGTAAAGCTCTGTGCCGG + Intronic
1071572750 10:86706895-86706917 AGGGGTGTGCACCACTGTGGCGG + Intronic
1072853329 10:98920574-98920596 AGGGCTGTTAAACACTGGGCTGG - Intronic
1072902379 10:99419764-99419786 GGAGCTGAGAACCAGTGTCCCGG + Intronic
1072913617 10:99523606-99523628 GGGGCTGTGAACCACCGTCAGGG + Intergenic
1073468104 10:103706131-103706153 GACACTGTGACCCACTGTGCGGG - Intronic
1074298470 10:112212145-112212167 GGGGCTGAGGACCACTAAGCAGG + Intronic
1075677349 10:124304538-124304560 GGGGATGTGAACCAACGTGAAGG - Intergenic
1076880212 10:133236269-133236291 GGGGCTTTGAGCCACTGCACAGG - Intergenic
1077284763 11:1760748-1760770 GGGGCTCTGGCCCACTGTGGGGG - Intronic
1077366788 11:2164480-2164502 GGAGCTCTGAGCCACTGTGAAGG - Intronic
1078226613 11:9397505-9397527 ACGGGTGTGAGCCACTGTGCTGG + Intronic
1083287440 11:61669428-61669450 GAGGTTGAAAACCACTGTGCTGG - Intergenic
1083771487 11:64870094-64870116 GGGGCTTTGAACAGCAGTGCTGG - Intronic
1084406684 11:68978332-68978354 TGGGCTGTAAAGCACTGTACAGG + Intergenic
1084697158 11:70762600-70762622 GGGTCTGTGCACCTCTGTACTGG - Intronic
1092289549 12:7150993-7151015 GGGGCTGGTGACCACGGTGCAGG - Exonic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1093784875 12:23181029-23181051 GGGACTGTGAATCTCTGAGCAGG + Intergenic
1094194338 12:27730746-27730768 CAGGCAGTGAGCCACTGTGCCGG + Intronic
1095379651 12:41575123-41575145 ACAGGTGTGAACCACTGTGCTGG + Intergenic
1095940463 12:47723696-47723718 GGGGCTGAGCACCAGTGTACAGG - Intronic
1096000913 12:48129539-48129561 GAGGCTGTGACCAAGTGTGCAGG - Intronic
1096591099 12:52659703-52659725 GGAGCTGTAAAACGCTGTGCAGG - Intergenic
1097226296 12:57478525-57478547 AGAGCTGTGACTCACTGTGCTGG + Exonic
1097868553 12:64580420-64580442 ACAGGTGTGAACCACTGTGCCGG - Intergenic
1100472063 12:94902430-94902452 AGAGGTGTGAGCCACTGTGCCGG - Intronic
1101940874 12:109098156-109098178 GGGGCGGGGCACCTCTGTGCAGG + Intronic
1102020459 12:109678741-109678763 GGGGCTGGCAGCCACTGTGAAGG - Intergenic
1102133102 12:110548998-110549020 GGTGCTGAGAACCACAGTGTAGG + Intronic
1103508020 12:121454453-121454475 GGGGCTGGGAACCAGAGGGCAGG - Intronic
1104103924 12:125641103-125641125 GGGGCAGTGGAGCACTGTGTGGG - Intronic
1111046478 13:82820467-82820489 GTTGCAGGGAACCACTGTGCTGG - Intergenic
1113046069 13:106156704-106156726 GTGGCTGTGACTCACTGGGCTGG - Intergenic
1113553203 13:111209167-111209189 GAGGCTGTGAAAAACTTTGCTGG - Intronic
1113976004 13:114227858-114227880 GGGGGTGTGCACCAGTGTGGGGG + Intergenic
1114192648 14:20452050-20452072 GTGGGTGTGAACCACTGTATAGG - Exonic
1114318379 14:21526493-21526515 GGTGCTGTGAAGCACTGCGGGGG + Intronic
1115063208 14:29220287-29220309 GGGGCAGTCAATCACTGTGATGG - Intergenic
1115428362 14:33287417-33287439 GGGGGTGTGAGCAACTGAGCAGG + Intronic
1117555188 14:56876702-56876724 GGTGCTGGAAACCACTGTGCTGG + Intergenic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119413872 14:74456711-74456733 GGAGCTGGAAACCACTGTCCAGG + Intergenic
1120928371 14:89821136-89821158 ACACCTGTGAACCACTGTGCTGG + Intronic
1121206162 14:92169858-92169880 ACAGGTGTGAACCACTGTGCTGG - Exonic
1121867244 14:97374035-97374057 GTGGGTGTGAGCCACTGTGGTGG - Intergenic
1122630024 14:103103501-103103523 GGGGCTGGGAACCGCTCCGCGGG - Intronic
1122939887 14:104976530-104976552 GGGTCTGGGAACCGGTGTGCTGG + Intronic
1123115540 14:105892591-105892613 GGGGCCGTGCACCACCGGGCAGG - Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125944442 15:43701661-43701683 ACAGCTGTGAGCCACTGTGCTGG - Intergenic
1127625954 15:60780346-60780368 AGGCCTGGGAACCACTGGGCTGG + Intronic
1128882866 15:71259580-71259602 AGGGCTGAGAACCACTGTGCTGG - Intronic
1129276200 15:74447338-74447360 GGAGCTGTGAACTACAATGCTGG + Intronic
1129603038 15:77011367-77011389 TGGGCTGGGCTCCACTGTGCTGG - Intronic
1130331419 15:82925222-82925244 GGGGCTGTGAAACCTTGGGCTGG - Intronic
1130653429 15:85775384-85775406 GTGGCCGTGAATCACTGTGCAGG - Intronic
1133073499 16:3262608-3262630 AGGGCCCTGAACCACTGTGGAGG + Intergenic
1133803710 16:9106560-9106582 GCAGGTGTGAGCCACTGTGCTGG + Intronic
1137932804 16:52604619-52604641 GGGGCTGGTGTCCACTGTGCAGG + Intergenic
1138190103 16:55007724-55007746 GGGTCTGTGCACCACAGTGCTGG - Intergenic
1138572251 16:57883412-57883434 GCAGATGTGAACCACTGTGCAGG + Exonic
1139324707 16:66143508-66143530 GGGACTGAGAACCACTGGCCTGG - Intergenic
1139699270 16:68697507-68697529 AGGGTCGGGAACCACTGTGCTGG - Intronic
1140112177 16:72013709-72013731 GGAGCTGAGAACCACGGTCCTGG + Intronic
1141431974 16:83974992-83975014 GGGAATGTGAACCGGTGTGCAGG + Intronic
1141432028 16:83975240-83975262 GGGAATGTGAACCGGTGTGCAGG + Intronic
1141712418 16:85707810-85707832 GGGCCTGGGAAACACTGTTCTGG + Exonic
1142368822 16:89666381-89666403 GCAGCCATGAACCACTGTGCCGG - Intronic
1142725625 17:1811457-1811479 ACGGGTGTGAACCACTGTGCTGG + Intronic
1145010446 17:19364850-19364872 GGGGCTGTCAGCCATTGGGCAGG + Intronic
1145249230 17:21288267-21288289 TGGGCTGGGAACCCCTGGGCAGG + Intronic
1145282045 17:21475310-21475332 GGGGCTGTGAGGCTCTGAGCAGG - Intergenic
1145395400 17:22490296-22490318 GGGGCTGTGAGGCTCTGAGCAGG + Intergenic
1146265354 17:31449239-31449261 GGGGCTGGGATCCAGTGTTCAGG - Intronic
1149460649 17:56827630-56827652 GGGGCTGCGATCCTCTGTGGAGG + Intronic
1150762863 17:67978260-67978282 GGGGCTGTGAACCACTGTGCTGG + Intronic
1151319956 17:73347083-73347105 ACAGGTGTGAACCACTGTGCTGG - Intronic
1154055500 18:11009424-11009446 AGGGCTGAGAACCACTGTGCTGG + Intronic
1156782184 18:40863812-40863834 GGGGCTGAGAAGCAATGTTCAGG - Intergenic
1158348668 18:56541682-56541704 AGGGCTGAGAACCACTGGTCAGG - Intergenic
1160739448 19:679269-679291 GTGCCTGTGAGCCGCTGTGCCGG + Intronic
1160987285 19:1844919-1844941 GGAGCTGTGAAGCCCTGAGCTGG + Intronic
1161069868 19:2254608-2254630 CCAGGTGTGAACCACTGTGCTGG - Intronic
1161174941 19:2836138-2836160 ACGGGTGTGAGCCACTGTGCTGG + Intergenic
1162047555 19:8010804-8010826 ACAGGTGTGAACCACTGTGCTGG - Intronic
1163367063 19:16881169-16881191 GGGGCTGGGAAAGGCTGTGCTGG + Intergenic
1163769127 19:19180090-19180112 GGGGCTGTAAACCACTGTTTTGG + Intronic
1164634489 19:29782253-29782275 GGGGCTGAGTATCAGTGTGCCGG - Intergenic
1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG + Intronic
1166894895 19:46016927-46016949 GGGCCTGGGAAGCACTGGGCGGG + Intronic
1167468292 19:49661884-49661906 TGAGTTGTTAACCACTGTGCAGG + Intronic
925159466 2:1673876-1673898 AGGGCTGGAAACCCCTGTGCTGG - Intronic
926051459 2:9747459-9747481 GGGGCTCTGTACAACTCTGCAGG + Intergenic
928491695 2:31790983-31791005 ACAGATGTGAACCACTGTGCTGG - Intergenic
929521628 2:42657788-42657810 GGCGGCGTGAGCCACTGTGCCGG - Intronic
929763795 2:44827665-44827687 GGAGATTTGAACCACTGTCCAGG + Intergenic
930675840 2:54199452-54199474 GGGGCCCTGAACCACTGCACAGG + Intronic
930780228 2:55217237-55217259 AAAGGTGTGAACCACTGTGCTGG - Intronic
931835299 2:66092734-66092756 AGGTTTGTGAACCACTGTGCTGG - Intergenic
934182882 2:89643183-89643205 ACAGGTGTGAACCACTGTGCCGG + Intergenic
937239693 2:120452129-120452151 AGGGCTGTGAACCTCAGTGTTGG + Intergenic
937357013 2:121204121-121204143 ACGGGTGTGAGCCACTGTGCCGG - Intergenic
941491460 2:166147001-166147023 AAGTCTGAGAACCACTGTGCTGG - Intergenic
944563133 2:200961426-200961448 GCAGGTGTGAACCACTGTGCTGG + Intronic
946044660 2:216810920-216810942 AGAGCTGAGAACCACTGTGATGG + Intergenic
946948508 2:224847315-224847337 GGGGCTCTGAGTTACTGTGCAGG + Intronic
946996486 2:225398166-225398188 GGGACTGAGAACCACTGTACTGG + Intergenic
947471881 2:230408611-230408633 GGGGCTGTTAATCACAATGCTGG - Intergenic
947910945 2:233800335-233800357 GGCGTGGTGACCCACTGTGCGGG - Intronic
948775237 2:240284563-240284585 GGGGATGGGAACCACTCTACGGG - Intergenic
948881796 2:240862055-240862077 ACAGGTGTGAACCACTGTGCCGG - Intergenic
1168756633 20:323060-323082 ACAGCTGTGAACCACTGTGCAGG + Intergenic
1169797611 20:9481483-9481505 GGGACTTTGAACCACTGGGGTGG - Intergenic
1172695445 20:36819569-36819591 CAGGTTGAGAACCACTGTGCTGG - Intronic
1173404209 20:42751200-42751222 GGAGCTGTAAACCCCTGTGCTGG - Intronic
1174081223 20:47971977-47971999 GGGTCTGGGAATCACTGTCCTGG - Intergenic
1174103443 20:48144840-48144862 GGTGCTGTGCAACACTGAGCAGG + Intergenic
1174135277 20:48374911-48374933 GGGTCTGGGAATCACTGTCCTGG + Intergenic
1174267181 20:49340403-49340425 GAGGCTGTGGACCACAGGGCAGG - Intergenic
1174289468 20:49497492-49497514 GGAGCTCTGAACCACTGTGTAGG + Intergenic
1175909179 20:62396509-62396531 GGGGGCGTGTACCTCTGTGCTGG + Exonic
1176545598 21:8196634-8196656 GGGGCTCTCAACCAGTGTGCGGG + Intergenic
1176564549 21:8379679-8379701 GGGGCTCTCAACCAGTGTGCGGG + Intergenic
1177836590 21:26192016-26192038 ACGGGTGTGAGCCACTGTGCTGG - Intergenic
1179010590 21:37553062-37553084 TGGGCTGCAAACCACTGAGCAGG + Intergenic
1179454823 21:41491899-41491921 GGTGGTATGAGCCACTGTGCCGG - Intronic
1179492225 21:41748064-41748086 CGGGCTGTAGGCCACTGTGCGGG + Intronic
1180885904 22:19243352-19243374 GCAGGTGTGAGCCACTGTGCTGG - Intronic
1181725463 22:24807797-24807819 GTGGCTGTCTGCCACTGTGCAGG - Intronic
1183722806 22:39572225-39572247 GGGGCTGGGGACCACTGAGGAGG + Intronic
1184227682 22:43138853-43138875 TGACCTGTGAAACACTGTGCAGG - Intronic
1184486045 22:44780213-44780235 ACAGCTGTGCACCACTGTGCCGG - Intronic
1203250469 22_KI270733v1_random:112871-112893 GGGGCTCTCAACCAGTGTGCGGG + Intergenic
949173858 3:1034857-1034879 GTGGCTTTGCAGCACTGTGCTGG + Intergenic
950054599 3:10014662-10014684 GGGACTGTGCACCACCATGCTGG - Intergenic
950577594 3:13842090-13842112 GGGCCTGTGAGCCACCGTGAAGG + Intronic
950964428 3:17136499-17136521 GGGACTGTGGCCCACTGTGTGGG + Intergenic
950968856 3:17166618-17166640 GGTGCTGTGTACAGCTGTGCAGG - Intronic
954432092 3:50476235-50476257 GGGGCTGTGCAGCTCTGGGCAGG - Intronic
954685712 3:52369132-52369154 GGTGCTCTGAGCAACTGTGCGGG - Intronic
956315429 3:67930421-67930443 GGGTCTATGTCCCACTGTGCAGG + Intergenic
956770986 3:72525832-72525854 ACAGCTGTGAGCCACTGTGCTGG - Intergenic
956937664 3:74121658-74121680 ACGGGTGTGAGCCACTGTGCTGG + Intergenic
959889282 3:111535522-111535544 TGTGCTGTGAATCACTCTGCAGG + Intronic
961034184 3:123630939-123630961 GGGACTGTGGGCAACTGTGCTGG - Intronic
961166879 3:124769679-124769701 AGGGCTGAGATCCACTGTCCCGG + Intronic
963060250 3:141219847-141219869 AGGGCTGGGAACCACTGTGGAGG - Intergenic
964028716 3:152110624-152110646 TGGGCTCTGATACACTGTGCAGG - Intergenic
966173171 3:177105822-177105844 GGGACTGAGAACCACTGGGTGGG + Intronic
966173256 3:177106791-177106813 TTGGCTGTGTACCTCTGTGCAGG + Intronic
966557709 3:181282620-181282642 CAGGCTGTGAGCCACTGTGCTGG + Intergenic
966897722 3:184458203-184458225 CAGGCTGTGAGCCACTGCGCTGG - Intronic
967919392 3:194603142-194603164 GGGGCTGGGAACCACAGCGGTGG + Intronic
968119948 3:196119118-196119140 ACAGCTGTGAGCCACTGTGCCGG + Intergenic
968485709 4:860210-860232 GGGGCCGTCAACCCCTGGGCTGG - Intronic
969134321 4:5017986-5018008 GAGGCTCTGAACCACAGAGCGGG - Intronic
969423517 4:7110736-7110758 TGGGCTGGGCACCACTGTGGAGG + Intergenic
969516179 4:7649359-7649381 GGGGCTGTGTACCCATGTGAGGG + Intronic
971595094 4:28516727-28516749 GTGGCTTTGAAGAACTGTGCTGG - Intergenic
972699582 4:41481331-41481353 GGGGCGGTGAAGCCCTGGGCTGG + Intronic
975260183 4:72288798-72288820 AGGGCTGGGGACCACTGTGATGG - Exonic
975686414 4:76920055-76920077 TGGGATGTGAACCACTGCTCTGG + Intergenic
979293346 4:119002521-119002543 AGTGCTGTGAGCCACTGTGCTGG + Intronic
979737105 4:124100696-124100718 GGGTTTTTGAATCACTGTGCCGG + Intergenic
980942557 4:139288345-139288367 AGGGCTGTGTTCCACTTTGCAGG + Intronic
982909201 4:161117982-161118004 GTGGCTTTGAAGCACTGTGGTGG + Intergenic
987091324 5:14510366-14510388 GTGTCTGTGAACCAGTCTGCAGG - Intronic
988462664 5:31454662-31454684 ACAGGTGTGAACCACTGTGCCGG - Intronic
988960539 5:36366730-36366752 AGGGCTGTGAACCACTTTTCTGG + Intergenic
989183096 5:38597689-38597711 GAGGTTGAGAACCCCTGTGCTGG + Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
990247195 5:53874677-53874699 GGGGCTGTGAAGCAATGGGTTGG + Intergenic
990308195 5:54514389-54514411 GTAGGTGTGAGCCACTGTGCTGG + Intergenic
990448975 5:55917934-55917956 TGGGCTCTGAACCAGTGTGAGGG - Intronic
992038892 5:72808970-72808992 GGGGGTGGGATCCACTGAGCTGG + Intergenic
992475568 5:77098570-77098592 AAAGGTGTGAACCACTGTGCTGG + Intergenic
992624041 5:78620755-78620777 GAGGCTGAGAAACCCTGTGCTGG + Intronic
995695674 5:114876130-114876152 GAGACTGTGTACCACTGTACTGG + Intergenic
997226125 5:132210711-132210733 GTGGCTGTGAACCCCAGTCCAGG - Intronic
998361532 5:141592224-141592246 TGGGCTGTGATTCACTTTGCTGG - Intronic
1004243193 6:13946644-13946666 GAGGCTGAGACCTACTGTGCTGG - Intronic
1004560296 6:16743411-16743433 GGTCCTGTGAACCACAGTGGTGG - Intronic
1004616668 6:17296878-17296900 GGGGCTGAGATCCAAAGTGCTGG + Intergenic
1005009831 6:21324820-21324842 CTGGGTGTGAGCCACTGTGCCGG + Intergenic
1005222744 6:23606746-23606768 AGGGGTGTGAGCCACTGTACTGG + Intergenic
1005899647 6:30206365-30206387 GGTGCTCTGAAGCACAGTGCAGG + Intronic
1007238539 6:40408567-40408589 GCTGCTGTGAACCACCATGCTGG - Intronic
1007698209 6:43747199-43747221 GAAGCTGTGAGCCACTGTTCAGG + Intergenic
1011028455 6:82895029-82895051 GCCACTGTGAGCCACTGTGCCGG - Intronic
1013646267 6:112144665-112144687 GGGGCTGAGAACTACTGAGTTGG + Intronic
1014817028 6:125947243-125947265 GCAGGTGTGAGCCACTGTGCTGG + Intergenic
1017747955 6:157463746-157463768 ACAGATGTGAACCACTGTGCCGG - Intronic
1018108701 6:160513887-160513909 GGGGGTGGGATCCACTGAGCTGG - Intergenic
1019497621 7:1347805-1347827 GAGGCTGCGAGCCCCTGTGCAGG + Intergenic
1022521792 7:31013223-31013245 GGGGCTGTGAAGCAGGGTGGAGG - Intergenic
1025188348 7:56878043-56878065 ACAGGTGTGAACCACTGTGCTGG + Intergenic
1026243649 7:68598845-68598867 GCAGGTGTGAGCCACTGTGCAGG - Intergenic
1028349017 7:89820163-89820185 GGACCTGTGTACCACTGGGCAGG + Intergenic
1029124584 7:98287501-98287523 GGGGCTGGGAATCAAGGTGCTGG + Intronic
1032196592 7:129792896-129792918 GGGGCTGGGAACCATCATGCTGG - Intergenic
1034038801 7:147854623-147854645 GTGGCTAGGAACCACTGTGCTGG - Intronic
1034462054 7:151203454-151203476 GGAGCAGTCCACCACTGTGCGGG - Exonic
1035107685 7:156455882-156455904 GGAGCTGTGCACCAGTGTGGAGG - Intergenic
1035243110 7:157544962-157544984 GGGGGTGTGCACAGCTGTGCAGG + Intronic
1035261807 7:157666639-157666661 GGGGCTGTGTGCCACTGGACAGG + Intronic
1035532271 8:362279-362301 GGAGCTGTGGTACACTGTGCTGG - Intergenic
1036187738 8:6638925-6638947 GGGGCTGTGACTGAGTGTGCGGG - Intronic
1036749571 8:11435262-11435284 GGGGCTGTCATCCCCTCTGCAGG - Intronic
1036795171 8:11750362-11750384 GGGGCTTTCAACTACTTTGCTGG + Intronic
1038532400 8:28328988-28329010 GGGCCTGTGATTCACTTTGCAGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041850710 8:62388925-62388947 GGGTCTGTGAGGCACTGGGCTGG - Intronic
1043666449 8:82820954-82820976 TGGGCTGTGTTCCACTGTGGGGG + Intergenic
1044160686 8:88910843-88910865 TGTACTGTGAAGCACTGTGCTGG + Intergenic
1044710480 8:95052664-95052686 TGGGCTATGAACCACTGTTCTGG - Intronic
1045781104 8:105864600-105864622 GGGTCTGAGAACTCCTGTGCTGG + Intergenic
1048266573 8:132992536-132992558 AGTGCTATGAAACACTGTGCAGG - Intronic
1049578664 8:143401009-143401031 GGGTCTGTGGCCCCCTGTGCAGG + Intergenic
1049699557 8:144003747-144003769 GTAGCTGTGAGCCACTGCGCCGG - Intronic
1049850429 8:144827468-144827490 GGGGCTGAGAACCACAGAGATGG + Intronic
1051162116 9:14220591-14220613 TGGGCTGTGATCCACTGTTGAGG - Intronic
1053131021 9:35615818-35615840 GGGGCAGTGAACCAGAGTGGTGG - Intronic
1056999170 9:91491821-91491843 GGGGCTGTCCAGCACCGTGCAGG - Intergenic
1057193437 9:93100038-93100060 GGGGCTGGGGACCACGGTGATGG - Intronic
1057864347 9:98667356-98667378 GGGGCTGCCATCCACTGTCCAGG + Intronic
1058694809 9:107550156-107550178 GCAGGTGTGAGCCACTGTGCTGG + Intergenic
1059356388 9:113702548-113702570 AGGCTTGAGAACCACTGTGCTGG - Intergenic
1060530099 9:124342954-124342976 GGGGCTGGGAACCACAGGGCCGG - Intronic
1062264976 9:135682900-135682922 GGGGCTGTGGACGCCTGGGCAGG - Intergenic
1062646960 9:137552649-137552671 GGCGCTGTGAACCTCTTTGGAGG + Intergenic
1062695492 9:137873724-137873746 GGGGCTGTGAGCAAGTGTGCTGG + Intergenic
1203466870 Un_GL000220v1:96143-96165 GGGGCTCTCAACCAGTGTGCGGG + Intergenic
1187288704 X:17931547-17931569 AGGGTTGAGAACCACTGGGCTGG - Intergenic
1189402487 X:40684344-40684366 GGGGTTGAGAACCACTGACCTGG + Intronic
1190845860 X:54189998-54190020 AGGGTTGAGAACCACTGAGCTGG + Intergenic
1192567459 X:72177171-72177193 AGGTCTGTGAACCTCTGTCCTGG + Intergenic
1193228439 X:79013371-79013393 GGGGGTGGGATCCACTGAGCTGG + Intergenic
1196602964 X:117623029-117623051 GGGGTTGGGATCCACTGAGCAGG + Intergenic
1199839738 X:151632471-151632493 GGGCCTGTGAGCAACTGTGAGGG + Intronic
1200060001 X:153479933-153479955 GGGTCTGTGAGCCACTTTGGAGG - Intronic
1200081421 X:153578638-153578660 GGGGCAGAGGGCCACTGTGCCGG + Intronic
1201727664 Y:17171266-17171288 GGGGCTGTGAACCAGAGAGGGGG - Intergenic