ID: 1150770503

View in Genome Browser
Species Human (GRCh38)
Location 17:68036692-68036714
Sequence AAGATTTCAAAGATGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150770501_1150770503 13 Left 1150770501 17:68036656-68036678 CCAAATTGAAATACGCTGTAAGC 0: 1
1: 0
2: 3
3: 28
4: 191
Right 1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG 0: 1
1: 0
2: 2
3: 30
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150770503 Original CRISPR AAGATTTCAAAGATGGAGTA TGG Intronic
902520974 1:17016267-17016289 AAGAATTCCAAGATGCTGTAGGG + Intergenic
902971708 1:20057792-20057814 AAAATTTGTAAGATGCAGTAGGG - Intronic
904538336 1:31215981-31216003 AAGATCTCAGAGCTGGAGTGGGG + Intronic
906178107 1:43793469-43793491 AAGATATCAAAGCTGTTGTAAGG - Intronic
906888270 1:49676686-49676708 AATATGTCAAAGATAGAGAATGG + Intronic
907205727 1:52768903-52768925 AAGAATTCAAAGATAGAGAAAGG - Intronic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
908104767 1:60830082-60830104 AAGATTGCCAAGATGTGGTAAGG + Intergenic
908696341 1:66846411-66846433 CAGCTTTCAAAGATGGATTAAGG - Intronic
909019138 1:70411900-70411922 TAAATTTTAAAGATGTAGTACGG + Intronic
910997649 1:93125686-93125708 AAGATTTCACAGTTGGGGTGGGG + Intronic
911489522 1:98546037-98546059 AAGTTTTCAAAGATGATTTAAGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
912328485 1:108793511-108793533 AGGATTTCAAAGTTGTAATATGG + Intronic
912961213 1:114197356-114197378 ATGATTCCAAAGAAGGAGAAGGG - Intergenic
915151983 1:153840823-153840845 AATATTTCAAAGATGGAGATAGG + Intronic
915762647 1:158330450-158330472 ATGATTGAAAAGATGGATTAGGG + Intronic
915945231 1:160145191-160145213 ATGATCTCAAAGATGCGGTAGGG + Intergenic
919235656 1:194838812-194838834 AAGACTTTGAAGATGGAGAAAGG + Intergenic
921607062 1:217168180-217168202 AAAATTTGAAAAATGGACTATGG - Intergenic
923541031 1:234888333-234888355 AAGATGGCAAAGAAGGAGGAAGG + Intergenic
1063551263 10:7035754-7035776 AACAGTTCAAACTTGGAGTAGGG - Intergenic
1067818300 10:49501415-49501437 AAGATTTTAAATAAGGAATATGG + Intronic
1068063979 10:52105545-52105567 AAGATTTCAAAGATAAACTAAGG - Intronic
1068316385 10:55348826-55348848 AGGACTTCAAAGATGCAGCATGG - Intronic
1070756711 10:78997874-78997896 AAGATTTCACAGGTGAAGAAAGG + Intergenic
1074803140 10:117022382-117022404 AAGGTTTCAAAAATAGTGTAAGG - Intronic
1075775787 10:124985985-124986007 AAGATTTTAAAAATGCAATAAGG + Exonic
1076036921 10:127206825-127206847 AAGCTTTGAAAAATGGAGCAGGG - Intronic
1078184240 11:9038252-9038274 AAGATTACAAAGAGGGGGTAGGG + Intronic
1078490507 11:11763673-11763695 AAGATCTCAAATCTGGAGTTGGG + Intergenic
1079467208 11:20742297-20742319 GAGAGTTCAAAGAGGTAGTAGGG + Intronic
1079572615 11:21963283-21963305 GAGCTTTTAAAGATGGAATATGG - Intergenic
1080091317 11:28352631-28352653 AAGAGTTCAAAGACAGGGTAAGG - Intergenic
1080438772 11:32271090-32271112 AAGACTACAAAGATGGAAAATGG + Intergenic
1080631217 11:34078560-34078582 AAGATTTTAAAGAGGGAGAGGGG - Intronic
1080635020 11:34116355-34116377 ATAATTTCAAATATGGTGTACGG + Intronic
1080649116 11:34208961-34208983 AAGAGTACAAAGCTGGAGCAAGG - Intronic
1082631355 11:55545915-55545937 AAGATTGTAAAGATGGAGTAAGG - Intergenic
1082958462 11:58896622-58896644 AAGGACACAAAGATGGAGTAGGG + Intronic
1084591013 11:70090344-70090366 AAGATCTCAAAGTTGTAGTCAGG - Intronic
1084617579 11:70246644-70246666 AAGTTTTGCAAGAGGGAGTAAGG - Intergenic
1085261304 11:75206441-75206463 ATGGTTTCAAAAATGGAATAAGG + Exonic
1087419042 11:97897328-97897350 AAAATTTCAAAGTTAGAGTCTGG + Intergenic
1088308596 11:108436397-108436419 AAGATATCATAGGTAGAGTATGG + Intronic
1090115102 11:123962357-123962379 AAAAATGCAATGATGGAGTAAGG + Intergenic
1093282755 12:17215835-17215857 AAGATTTGAAAGAAGGAGCAGGG - Intergenic
1095520099 12:43053114-43053136 CAGATTTCAAAGACTTAGTATGG + Intergenic
1095576531 12:43746651-43746673 AAGAATTGAAAGTTTGAGTAAGG - Intronic
1095838950 12:46670729-46670751 AAGCTTACAATGATGGTGTAAGG + Intergenic
1095934849 12:47667048-47667070 AAGATTTCAAAGATGAGTAATGG + Exonic
1096222430 12:49839681-49839703 AAGAATTCAAAGTTAGAGAAAGG - Intronic
1096620171 12:52859583-52859605 AAGATCTCAAAGATGGAAAGAGG + Intergenic
1097207380 12:57334266-57334288 AATGTTTCAAAAATGGTGTAAGG - Intronic
1097691707 12:62740109-62740131 GACATTTCAAAGGTGGAGTTCGG - Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1098826464 12:75303891-75303913 AAGACTTTGAAGATGGAGGAAGG + Intronic
1099450406 12:82801120-82801142 AGGATTTCAGGCATGGAGTAAGG + Intronic
1100074060 12:90756622-90756644 AAGACTTTAAAGATGGATTCAGG - Intergenic
1100494135 12:95109209-95109231 AAGATGACAAGGCTGGAGTATGG - Intronic
1100638560 12:96459161-96459183 AAGGTTTAAAAAATGGGGTATGG - Intergenic
1100684856 12:96976488-96976510 AAGATTGGAAAACTGGAGTATGG + Intergenic
1104357698 12:128102362-128102384 AAGATTTAAAAGATGAAACATGG - Intergenic
1104484543 12:129139036-129139058 ACGATTTCAAAGCTGGGGGAAGG - Intronic
1104925356 12:132311228-132311250 GACATTTCAAAGAGGGAGAAAGG + Intronic
1105613984 13:21995985-21996007 AAGATTTTAAAGACAGGGTAAGG + Intergenic
1106692949 13:32138624-32138646 AAGATTTCTAAGAGGCAGTAAGG + Intronic
1107063767 13:36189581-36189603 AAGTTTTCTAAGACAGAGTAAGG - Intronic
1107689232 13:42935296-42935318 AAGATTTAAAAAATGGACTATGG - Intronic
1109138338 13:58681818-58681840 AGGATCTCAAATAGGGAGTATGG + Intergenic
1109894150 13:68660631-68660653 AAGATTTCTAAGAGAGAGTTAGG - Intergenic
1110152788 13:72275131-72275153 AAGAGTTCAAACAAGGAGCAAGG - Intergenic
1110162886 13:72400606-72400628 AAGATTTGAAAGATGGAAAGTGG + Intergenic
1110708491 13:78623582-78623604 ACGATTTCAAACATGGTGTATGG - Intronic
1113680796 13:112243462-112243484 TAAATTTAAAAGATGGAGGAGGG - Intergenic
1114769539 14:25412618-25412640 AAGATTTTCAAGATAGAGTACGG + Intergenic
1115824732 14:37256366-37256388 AAGATTTGGAATATGGAGTATGG + Intronic
1117208027 14:53464806-53464828 AAGATTTCTAAGATGTGGTTAGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117442173 14:55770291-55770313 AAGAGTTCAGAGATGGAAGATGG + Intergenic
1117852422 14:59989280-59989302 AAGATTTCACATATGGATAATGG - Intronic
1117865638 14:60146173-60146195 AATATTTCAAAGATGGTGGTAGG + Exonic
1119917934 14:78419503-78419525 AAAATTTAAAAGTTGGACTATGG - Intronic
1120028825 14:79616505-79616527 AAGAATTTAAAAATGGAATAAGG + Intronic
1120655255 14:87181510-87181532 AAGCTTTGAAAGATGGAGCACGG - Intergenic
1121239925 14:92421806-92421828 AAGTTTTAAAACATGGTGTATGG - Intronic
1123697999 15:22893049-22893071 AAGATTTAGTAGATGGATTATGG - Intronic
1127391452 15:58508211-58508233 AAGAATTGAGAGATGGGGTAGGG + Intronic
1127810900 15:62564447-62564469 AAGATTTCAGAGAATGAGAAAGG + Intronic
1128352711 15:66901740-66901762 AATATTTCAAAGAGGGAGCCAGG - Intergenic
1128487684 15:68111076-68111098 AAGATTTGGAGTATGGAGTATGG - Intronic
1128780054 15:70353386-70353408 AGGAATTCAAAGAAGGAGTAAGG + Intergenic
1128848473 15:70925065-70925087 TAGATTTCAGAGTTGGAATATGG - Intronic
1130718738 15:86364606-86364628 AGGATTTCAAATATGGGGCAGGG - Intronic
1130970452 15:88728089-88728111 AAGGTAGCAAAGATGGGGTAGGG + Intergenic
1131725795 15:95223147-95223169 AACTTTTCAAACATGGAGAAAGG - Intergenic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1134174133 16:11992280-11992302 AAAATTTAAGAGATGGAGTCTGG - Intronic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1137876407 16:52000514-52000536 CATATTTCAAAGACTGAGTATGG - Intergenic
1139463451 16:67141219-67141241 TAGATTTCACAGAGGGAGTGAGG + Intronic
1140396307 16:74629841-74629863 AAGTTATCAAAAAGGGAGTAGGG - Intronic
1142583587 17:956827-956849 AAGATCTCAAAGCTGGAGAGCGG + Intronic
1143302423 17:5920626-5920648 AAGATTTCCAAGATATAGTAAGG + Intronic
1144419370 17:15082187-15082209 AAGAATTCAGCCATGGAGTAGGG - Intergenic
1146168062 17:30607252-30607274 AAGCTTTCAAATAAGGAATATGG - Intergenic
1146569906 17:33943321-33943343 GAGTTTTCAAAGATGAAGTGCGG - Intronic
1146802862 17:35841096-35841118 AAGATTTGAACTATGGAGTTAGG - Intronic
1148057043 17:44805504-44805526 AAGATTGCCAAAATGGAGCACGG - Exonic
1148131503 17:45265067-45265089 AAGCTTTCAAAGAAGTAGAATGG - Intronic
1149192542 17:54081673-54081695 AAGCGTCCAAACATGGAGTAAGG + Intergenic
1149208075 17:54272037-54272059 AAAATTTGAAAGGTAGAGTAGGG + Intergenic
1149275291 17:55027093-55027115 AAGAGTTCACACAGGGAGTAGGG - Intronic
1149451946 17:56756541-56756563 AAGATTTAAAAAAAGGAGTGTGG - Intergenic
1150770503 17:68036692-68036714 AAGATTTCAAAGATGGAGTATGG + Intronic
1151129650 17:71883186-71883208 AAGGCTTGAAAGATGGAGGAGGG + Intergenic
1151647648 17:75444343-75444365 AGTATTTCTAAGATGGAGAAGGG + Intronic
1151749795 17:76030062-76030084 CAGATTTCAAAGACGTACTATGG + Intergenic
1153637697 18:7127403-7127425 AGGAATTCAAAGGTGGAGAAAGG - Intergenic
1156196278 18:34777330-34777352 ATGATGTCAAAGATAGTGTATGG + Intronic
1156997022 18:43481124-43481146 AAAATTTTAAACATGGAGAAGGG + Intergenic
1157246123 18:46056652-46056674 AAGAGTTCAAAGCTGCAGTGAGG + Intronic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157537246 18:48468882-48468904 AAGAATTCTAAGATGTAGTCAGG + Intergenic
1157964941 18:52197621-52197643 AAGCTTTCTAAGGTGGAGTCAGG + Intergenic
1158026600 18:52905415-52905437 AAGATTTAAAAGCTGGAATTAGG - Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158904115 18:61995097-61995119 AGGCTCTCAAAGATGTAGTAAGG - Intergenic
1158993957 18:62898163-62898185 AAGAAGTCAAAGAAGGAATAGGG - Intronic
1159619384 18:70619941-70619963 AAGACTTGAAAGAGGCAGTACGG - Intergenic
1163132847 19:15286594-15286616 TAGATTTCACAGATTTAGTAAGG - Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1164955750 19:32382494-32382516 GAGACTTCAAAGAAGGAGGATGG - Exonic
1165282227 19:34807266-34807288 AAGATTTGAAAGTAGGAGTCCGG + Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167003589 19:46760562-46760584 AACATTTCAAAAATTGAGCAGGG + Intronic
1167094627 19:47368038-47368060 AAGATTTCCAAGACGTCGTATGG - Intronic
1167182718 19:47917591-47917613 AAGATTTCCAAGACGTCGTATGG + Intergenic
1167450538 19:49565805-49565827 ATGATGTCCAAGATGGAGTGGGG - Intronic
1167541866 19:50093420-50093442 AAGATTTCCAAGACGTCGTATGG - Intergenic
1167543846 19:50107955-50107977 AAGATTTCCAAGACGTCGTATGG - Intergenic
1167544520 19:50113309-50113331 AAGATTTCCAAGACGTCGTATGG - Intergenic
1167545195 19:50118659-50118681 AAGATTTCCAAGACGTCGTATGG - Intergenic
1167545872 19:50124011-50124033 AAGATTTCCAAGACGTCGTACGG - Intergenic
1167546549 19:50129346-50129368 AAGATTTCCAAGACGTCGTACGG - Intergenic
1167547209 19:50134680-50134702 AAGATTTCCAAGACGTCGTATGG - Intergenic
925700586 2:6633324-6633346 GAGATTTCAAGGAAGGGGTAAGG - Intergenic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
929036822 2:37701332-37701354 AAGACTACAAATATGGTGTAGGG - Intronic
929222493 2:39478744-39478766 GAGATTTCAAAGATGGAAACAGG + Intergenic
929743913 2:44635521-44635543 AAGATATGCAAGATGGAGCATGG - Intronic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
932865996 2:75343813-75343835 CAGATTCAAAAGATGGAGCAAGG - Intergenic
935601316 2:104924933-104924955 CAGATTTCAAAAATAAAGTAGGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936644433 2:114352163-114352185 AAGAGTTCTAAGAAGGAGAATGG - Intergenic
937712550 2:124995071-124995093 AAGAATTTAAACATGGAGTTTGG + Intergenic
938679396 2:133673967-133673989 AAGAATGCTAAGTTGGAGTATGG - Intergenic
939150334 2:138464923-138464945 ATCATTTAAAAGATGGAATAAGG + Intergenic
939254164 2:139721121-139721143 AAGATTTGAAAGCTGGCATACGG - Intergenic
940431394 2:153593859-153593881 AAGATTTCAAAGAAGCAGAAAGG - Intergenic
940636073 2:156298621-156298643 AAGATTTGAAGGTTGGATTAGGG - Intergenic
942528730 2:176885373-176885395 CAGATTTCATGGCTGGAGTATGG - Intergenic
944017092 2:195054267-195054289 AGGAGTTCAAGGATGCAGTAAGG + Intergenic
944382035 2:199122152-199122174 AACATTTCAAAGAACGAGAATGG - Intergenic
945145307 2:206732223-206732245 AAGATTTCAAGGATAAAGAAGGG + Intergenic
946530045 2:220560844-220560866 AGGATTTCAAAGGTGTAGGAAGG - Intergenic
946562956 2:220933842-220933864 AAACTTTCAAAAATGTAGTATGG - Intergenic
946611471 2:221463008-221463030 AAGCCTCCAAAGATGGACTAGGG + Intronic
947034836 2:225840671-225840693 AATATTTCAAAGATGCTCTATGG - Intergenic
948323726 2:237093831-237093853 AAAATTACAAAGATGGAAAAAGG - Intronic
1169478279 20:5952054-5952076 AAGATTTCAAAGCTGGAAAAGGG + Exonic
1169662286 20:7993203-7993225 AAGATTATAAAGATGGAAGAAGG - Intronic
1169675264 20:8145895-8145917 AAGATTTCAAAGACTAAGAATGG - Intronic
1170345358 20:15380313-15380335 AAGCTTTCAAAGTAGGACTAGGG + Intronic
1175502210 20:59458602-59458624 AAGATATGAAAGATGAAGGATGG - Intergenic
1175739330 20:61409588-61409610 ATCATTTCAAAGAGGCAGTAAGG + Intronic
1175822374 20:61917317-61917339 AAGATTTCACAACTGGAGGAGGG - Intronic
1176689890 21:9893358-9893380 AAAATTTTAAAGATAGAGTAAGG - Intergenic
1177040448 21:16103569-16103591 AAAATTTCAAATATGTAGAAAGG - Intergenic
1178228494 21:30753144-30753166 AAGATTTCAGTGATAGAGTTTGG + Intergenic
1180670665 22:17550050-17550072 AAAATTTCAAAGATAAAGTTGGG - Intronic
1182654081 22:31875950-31875972 AATATTTCAAACATGCAGAAGGG - Intronic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1185409828 22:50676029-50676051 AAGACTTCACAGCTGGAGAAAGG - Intergenic
951993003 3:28696856-28696878 AAGATTTCACAGATTGAGAAAGG - Intergenic
952178096 3:30888746-30888768 AAGATATTAAAAATGAAGTAGGG + Intronic
952458739 3:33501596-33501618 AAGTTTTGAAAGATGTACTATGG + Intronic
952505326 3:34002065-34002087 GAAATTTCCAAGATGGAGAATGG - Intergenic
952652054 3:35738641-35738663 AAGATCTCAAGGATGGTGTTGGG + Intronic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
952821728 3:37491822-37491844 AACATTTAGAAGATGGATTAGGG + Intronic
954359879 3:50115875-50115897 AAGATTTGAAAGACACAGTAAGG - Intronic
955726552 3:61939575-61939597 AACATTTCAGAAATAGAGTATGG - Intronic
956647350 3:71469289-71469311 CAGATTTCAAAGAAGGAAAAAGG + Intronic
956724949 3:72149199-72149221 CAGATTTCAAATATTTAGTAAGG + Intergenic
956768625 3:72505767-72505789 ATAATTTCAAAGATGAACTAAGG - Intergenic
957268223 3:77995167-77995189 AAGAATGCAAGGATGGAGTCAGG + Intergenic
957467046 3:80607741-80607763 AAGATTTCAAAGCTGGAAAGTGG + Intergenic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
959730446 3:109595338-109595360 AAGATCTCAGAGATTGTGTATGG - Intergenic
960119772 3:113935919-113935941 AAGATTTCAAAGACAGATTATGG - Intronic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
960448447 3:117777304-117777326 AAGATTTTCAAGATGGCATAAGG - Intergenic
960709733 3:120515882-120515904 AAGAGCTAAAAGATGGACTATGG - Intergenic
960998961 3:123359499-123359521 AAGATCTGGAAGAGGGAGTAGGG - Intronic
961297226 3:125895175-125895197 AAAAATTAAAAGATGGAGTGGGG - Intergenic
962228114 3:133633367-133633389 AGTATTTCAAAGAGGGAGGAGGG - Intronic
963349122 3:144131502-144131524 AAGATTACAATGATGGTGGAAGG + Intergenic
963828043 3:149976695-149976717 AAGATTTAAAATATGAAGTGTGG + Intronic
964436340 3:156657981-156658003 AAGCTTTCAATCATGGAGGAAGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965270275 3:166607601-166607623 AGGATTTCAAAGAAGGAGCCAGG + Intergenic
965532374 3:169785592-169785614 AAGAGTTCAAAGATGGAGATGGG + Intronic
966235195 3:177693322-177693344 AAGATTTTAAAAATAGAATAAGG - Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
966639988 3:182178969-182178991 AATATTTCAAGGCTGAAGTAGGG - Intergenic
970779270 4:19716255-19716277 AACCTTTCACAGATGGAGCAGGG - Intergenic
970825186 4:20263682-20263704 AAGTTTTGAAAGATGAAGCAAGG - Intronic
972134431 4:35874382-35874404 AAAATCTCAAAGAAGGTGTAAGG - Intergenic
972409758 4:38781628-38781650 AAGATATTAAAGATGTATTAAGG - Intronic
973278107 4:48331610-48331632 AATATTTCCAAGAGGGAATATGG - Intergenic
973574249 4:52270155-52270177 CAGAATTCAAAATTGGAGTAAGG + Intergenic
975768862 4:77699274-77699296 AATATTACAAAGATGTAGGAGGG - Intergenic
977749611 4:100593502-100593524 TTGATTTCACAGATGAAGTATGG - Intronic
977956928 4:103039186-103039208 AAGATTTAAAATATGGAGATTGG - Intronic
978057276 4:104286734-104286756 AAGATATAAAATATTGAGTAAGG + Intergenic
979037307 4:115738374-115738396 AAGCTTTAAAAGATGTAGTAAGG - Intergenic
979390362 4:120120103-120120125 ATGATTTCAGAAATGGAGTCTGG + Intergenic
979661587 4:123261850-123261872 AGGAGTTCAAAGTTGCAGTAAGG - Intronic
979756696 4:124349527-124349549 AATATTTCAAAGAGGCAGTTTGG - Intergenic
980195556 4:129583523-129583545 AGGGTATCAAAAATGGAGTAAGG - Intergenic
980342865 4:131573373-131573395 AAAATGTCAAAAATGGATTATGG - Intergenic
980353298 4:131711303-131711325 AAATTTTTAAAGATAGAGTAAGG - Intergenic
980407868 4:132377152-132377174 AAGATATTAAATATGGAGTGAGG + Intergenic
981177880 4:141703013-141703035 AAGATTTCACAAAGGGAGTGGGG + Intronic
981245953 4:142538183-142538205 ATGCTTACAAAGAAGGAGTATGG - Intronic
982860882 4:160447554-160447576 AAGAGTCCAAAGAAGCAGTATGG - Intergenic
983015403 4:162606881-162606903 AAGCTTTCAACCATGGTGTAAGG - Intergenic
984356818 4:178670687-178670709 AAGATTTTAAAGTTGAAGAAAGG - Intergenic
984364206 4:178777324-178777346 GAGATTTGAAAGATGGAGGCTGG + Intergenic
985376636 4:189347386-189347408 AAGATTTCAAAATTGCACTATGG - Intergenic
987640607 5:20607025-20607047 TGGCTTTCAAAGATGGAGGAAGG + Intergenic
988700521 5:33669390-33669412 AACATTTCACAGATTGAATATGG - Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
990019316 5:51105754-51105776 AAGATGTCAGAGATGGGGAATGG + Intergenic
990113975 5:52366136-52366158 AAGATTTGGAAGAATGAGTAGGG + Intergenic
991665648 5:68997152-68997174 AAGATGTCACAGAGGGTGTACGG + Intergenic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992945863 5:81809722-81809744 AAGATTTTAAAGATTGCTTATGG + Intergenic
993071961 5:83176425-83176447 AAAATTTTAAAGATTGAGCAAGG + Intronic
993199073 5:84789230-84789252 AAGATTGCTGAGAAGGAGTATGG - Intergenic
993325926 5:86536459-86536481 AAAATATCTAAGATGGAATAAGG + Intergenic
993418268 5:87663793-87663815 ATAATTTAAAAAATGGAGTAAGG + Intergenic
993604360 5:89970085-89970107 AAGGAATCAAAGATGGAGAATGG + Intergenic
993651075 5:90522827-90522849 AAGATTTCAAGGAGGAAATATGG - Intronic
993743952 5:91573235-91573257 AAGAATTAAAGGATGGAGTGGGG - Intergenic
993819955 5:92601905-92601927 AAGATTTCATCTATGCAGTAAGG + Intergenic
994813295 5:104550470-104550492 AAAATTCCTAAGATGGAGTGGGG + Intergenic
995196705 5:109378442-109378464 AAGTGTTCAAAGATGGAGAGAGG - Exonic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
996330324 5:122321280-122321302 CAAATTTCAAAGATGTAATATGG - Intronic
998487994 5:142520320-142520342 AAGATGTAAAATATGGAGAAGGG - Intergenic
1001352110 5:170979294-170979316 AATATTTCAAATATAGAGAAAGG - Intronic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1003628575 6:7765989-7766011 AAGATTTTTGAGATGGAGAAAGG - Intronic
1003959779 6:11198290-11198312 AAGATTTCCAAGAGGAAGGAGGG - Intronic
1008833847 6:55802894-55802916 AATACTTCAAAGGGGGAGTATGG + Intronic
1009818769 6:68772341-68772363 TAGATTTCAGAAATGGAGTCAGG + Intronic
1010558293 6:77313714-77313736 ATGATTTGAAAGACGGAGGAAGG + Intergenic
1010967208 6:82224889-82224911 AAGACTTAAAAGATGCAGTTTGG + Intronic
1010992459 6:82495033-82495055 AAGATTTCAGAAATGTGGTAAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011946903 6:92916216-92916238 AAGATTTCACAGTCAGAGTAAGG - Intergenic
1012622290 6:101360500-101360522 AAGAAATCACAGATGAAGTATGG + Intergenic
1013065642 6:106682501-106682523 AAAATTGTAAAGATGGAGTCTGG + Intergenic
1013493371 6:110672729-110672751 GAGATTTCCAAGATAGAGTAAGG - Intronic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014140774 6:117939521-117939543 AAAATTTCAAAGATGTATTGAGG - Intronic
1014196026 6:118559943-118559965 ATGATTCCAAAGATATAGTATGG - Exonic
1014404920 6:121039523-121039545 AAGTTTTTAAAGATGGTGTCTGG + Intergenic
1017673600 6:156791906-156791928 AAGATTTCAAAAATATAGTTTGG - Intronic
1018642817 6:165920357-165920379 AATTTTTGAAAGAAGGAGTAAGG - Intronic
1018896369 6:168020803-168020825 AGGATTTAAAAGATGGAAAAAGG + Intronic
1021190086 7:17610162-17610184 AAGCTTTCAATCATGGAGGAAGG - Intergenic
1021364212 7:19756304-19756326 TAGATTTCAAAGACTGAGTATGG - Intronic
1022333168 7:29399035-29399057 AAGATATCAAGTAAGGAGTAGGG - Intronic
1026127380 7:67591342-67591364 AAGATTTCAAAGCTAGATAAGGG - Intergenic
1026434101 7:70379129-70379151 AGGATTTCAAAGATGGTTGAAGG - Intronic
1027945928 7:84746324-84746346 AAGTTTTAAAACATGAAGTATGG - Intergenic
1028713368 7:93936489-93936511 AGGTTTTCAATGATGGAATACGG + Intergenic
1028753522 7:94409456-94409478 AAGAAAACAAAGGTGGAGTATGG + Intronic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1030608933 7:111668134-111668156 CAGATTTTGAAGATGGAGAAAGG + Intergenic
1030863488 7:114668342-114668364 AAGGGTTAAAATATGGAGTATGG - Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1031842517 7:126761414-126761436 AAGAAGTCAAAGATAGAGGAAGG - Intronic
1032190589 7:129763167-129763189 AATATTTCAAAGTTAGATTATGG - Intergenic
1032327826 7:130948479-130948501 AAGATTCCAGAGATGGATGATGG + Intergenic
1032583467 7:133125344-133125366 AAGATTTCAAAGATGGTGGGAGG + Intergenic
1034047415 7:147944365-147944387 AAGATGTTCAAGATGCAGTAAGG + Intronic
1034565618 7:151912356-151912378 AAGAATTCTAAGCTGGAGTTAGG + Intergenic
1035333820 7:158113132-158113154 AAGAATTCCAAGAAGGAGAAGGG + Intronic
1037216895 8:16465164-16465186 GAAATTACTAAGATGGAGTAGGG + Intronic
1038979322 8:32739920-32739942 AAGAATTCAAAGAAGCAGGATGG + Intronic
1039037191 8:33372702-33372724 AAGAGCTCAAAGGTGGAGTCCGG + Exonic
1042636568 8:70882332-70882354 AAGATTTAAAAAATGCAGAAGGG + Intergenic
1043006804 8:74829991-74830013 AAGATTTTAGAGAAGGATTAGGG + Intronic
1043105319 8:76102390-76102412 AAGATTTCAAAGATTTATTCTGG - Intergenic
1043357997 8:79436286-79436308 AAGTTTTCAAAGATGAATCAGGG - Intergenic
1043828501 8:84959356-84959378 CAGATTTCAAATATAAAGTAAGG - Intergenic
1043941002 8:86195934-86195956 GAGATTTCAAGGAAGGATTAAGG + Intergenic
1046484673 8:114871767-114871789 ATGTTTTCAAAGATTGTGTAGGG - Intergenic
1048402449 8:134084390-134084412 AACATCTCAAAGATGCTGTAAGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1053342929 9:37353906-37353928 AAGATTTCAAACATGCTGAATGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053779371 9:41588109-41588131 AAAATTTTAAAGATAGAGTAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054670215 9:67782550-67782572 AAAATTTTAAAGATAGAGTAAGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055327969 9:75151755-75151777 AGTAATTCAAAGATGAAGTAGGG + Intergenic
1057867935 9:98696192-98696214 AGGATTTAAAAGATGAAGAAAGG + Intronic
1058654120 9:107204126-107204148 AAAATTTCTAAGAGGGGGTAGGG - Intergenic
1059215791 9:112560919-112560941 AAGAATTCACAGATGAAGAAGGG - Intronic
1059286292 9:113174674-113174696 GAGTTTTCAGAAATGGAGTAAGG - Intronic
1059631921 9:116134238-116134260 AAGATTAAAAAGATGGAGATGGG + Intergenic
1060306886 9:122421727-122421749 AAGATTTCTCAGATGGAGAATGG - Intergenic
1060598287 9:124861332-124861354 AGGATTTCAAAGTTGGCTTAAGG - Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1186143270 X:6599786-6599808 AAGATTTGAAAGATAAAATACGG - Intergenic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188436928 X:30171436-30171458 AAGATTTCAAAGATGGCTCATGG - Intergenic
1188810328 X:34646445-34646467 AAACTTTCAAAGATGGTGCATGG - Intronic
1189057261 X:37711180-37711202 AAGATTTTTAAGATTTAGTATGG + Intronic
1191607284 X:63076623-63076645 AAGACAGCAAAGAGGGAGTAGGG + Intergenic
1192493837 X:71599892-71599914 AAAACTTCAAATATGCAGTAAGG - Intronic
1193476022 X:81966922-81966944 AAAATGTCAAATATGGAGAAAGG - Intergenic
1194698132 X:97080867-97080889 ATGATTACAAAGATGGATTGAGG - Intronic
1196376104 X:115034249-115034271 AAGATTTCAATCATGGTGGAAGG - Intergenic
1198151038 X:133910083-133910105 AAGAGATGAAGGATGGAGTAGGG - Intronic
1198685125 X:139220723-139220745 AAGATTTGAAAGATAGGTTAGGG + Intronic
1199159492 X:144591635-144591657 AAGAGATCAAAGTTGGAGTTGGG + Intergenic