ID: 1150774700

View in Genome Browser
Species Human (GRCh38)
Location 17:68070117-68070139
Sequence GCCCCCTTTATCCCCCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150774700_1150774702 0 Left 1150774700 17:68070117-68070139 CCCTTAAGGGGGATAAAGGGGGC No data
Right 1150774702 17:68070140-68070162 TGTGAATGAAGAAACTAAAATGG No data
1150774700_1150774703 11 Left 1150774700 17:68070117-68070139 CCCTTAAGGGGGATAAAGGGGGC No data
Right 1150774703 17:68070151-68070173 AAACTAAAATGGAGTCTGTCTGG 0: 23
1: 16
2: 9
3: 33
4: 360
1150774700_1150774704 25 Left 1150774700 17:68070117-68070139 CCCTTAAGGGGGATAAAGGGGGC No data
Right 1150774704 17:68070165-68070187 TCTGTCTGGCTCTCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150774700 Original CRISPR GCCCCCTTTATCCCCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr