ID: 1150777717

View in Genome Browser
Species Human (GRCh38)
Location 17:68094902-68094924
Sequence AGTGTTGCCAAGAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150777708_1150777717 13 Left 1150777708 17:68094866-68094888 CCATTAGGCACCTTCTTCTGCAG No data
Right 1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG No data
1150777713_1150777717 -10 Left 1150777713 17:68094889-68094911 CCACCAGTGGGGCAGTGTTGCCA No data
Right 1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG No data
1150777709_1150777717 3 Left 1150777709 17:68094876-68094898 CCTTCTTCTGCAGCCACCAGTGG No data
Right 1150777717 17:68094902-68094924 AGTGTTGCCAAGAGGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150777717 Original CRISPR AGTGTTGCCAAGAGGGTACC AGG Intergenic
No off target data available for this crispr