ID: 1150779343

View in Genome Browser
Species Human (GRCh38)
Location 17:68107560-68107582
Sequence CACTGGGTATGAGTGGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150779338_1150779343 12 Left 1150779338 17:68107525-68107547 CCGAATAGTTCTGCGTGTGTTCT No data
Right 1150779343 17:68107560-68107582 CACTGGGTATGAGTGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150779343 Original CRISPR CACTGGGTATGAGTGGCAAG AGG Intergenic
No off target data available for this crispr