ID: 1150784223

View in Genome Browser
Species Human (GRCh38)
Location 17:68150023-68150045
Sequence ATAGTTCAACCTGTGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150784223_1150784228 19 Left 1150784223 17:68150023-68150045 CCCAGGTCCACAGGTTGAACTAT No data
Right 1150784228 17:68150065-68150087 TGCTGAGCTTGATCCTGACCTGG No data
1150784223_1150784229 25 Left 1150784223 17:68150023-68150045 CCCAGGTCCACAGGTTGAACTAT No data
Right 1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150784223 Original CRISPR ATAGTTCAACCTGTGGACCT GGG (reversed) Intergenic
No off target data available for this crispr