ID: 1150784225

View in Genome Browser
Species Human (GRCh38)
Location 17:68150030-68150052
Sequence CAGTGTCATAGTTCAACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150784225_1150784229 18 Left 1150784225 17:68150030-68150052 CCACAGGTTGAACTATGACACTG No data
Right 1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG No data
1150784225_1150784228 12 Left 1150784225 17:68150030-68150052 CCACAGGTTGAACTATGACACTG No data
Right 1150784228 17:68150065-68150087 TGCTGAGCTTGATCCTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150784225 Original CRISPR CAGTGTCATAGTTCAACCTG TGG (reversed) Intergenic
No off target data available for this crispr