ID: 1150784229

View in Genome Browser
Species Human (GRCh38)
Location 17:68150071-68150093
Sequence GCTTGATCCTGACCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150784223_1150784229 25 Left 1150784223 17:68150023-68150045 CCCAGGTCCACAGGTTGAACTAT No data
Right 1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG No data
1150784224_1150784229 24 Left 1150784224 17:68150024-68150046 CCAGGTCCACAGGTTGAACTATG No data
Right 1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG No data
1150784225_1150784229 18 Left 1150784225 17:68150030-68150052 CCACAGGTTGAACTATGACACTG No data
Right 1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150784229 Original CRISPR GCTTGATCCTGACCTGGTGT TGG Intergenic
No off target data available for this crispr