ID: 1150790312

View in Genome Browser
Species Human (GRCh38)
Location 17:68197161-68197183
Sequence TCCCTCCCGCACGCGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150790312_1150790323 21 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790323 17:68197205-68197227 AATCCCCAGGTGAGGGGAGAAGG No data
1150790312_1150790325 23 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790325 17:68197207-68197229 TCCCCAGGTGAGGGGAGAAGGGG No data
1150790312_1150790321 14 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790321 17:68197198-68197220 GACAGCAAATCCCCAGGTGAGGG No data
1150790312_1150790320 13 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790320 17:68197197-68197219 GGACAGCAAATCCCCAGGTGAGG No data
1150790312_1150790327 24 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790327 17:68197208-68197230 CCCCAGGTGAGGGGAGAAGGGGG No data
1150790312_1150790322 15 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790322 17:68197199-68197221 ACAGCAAATCCCCAGGTGAGGGG No data
1150790312_1150790330 28 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790330 17:68197212-68197234 AGGTGAGGGGAGAAGGGGGAAGG No data
1150790312_1150790319 8 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790319 17:68197192-68197214 CGCAGGGACAGCAAATCCCCAGG No data
1150790312_1150790318 -8 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790318 17:68197176-68197198 GGGAGGGACGCAGGGACGCAGGG No data
1150790312_1150790324 22 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790324 17:68197206-68197228 ATCCCCAGGTGAGGGGAGAAGGG No data
1150790312_1150790317 -9 Left 1150790312 17:68197161-68197183 CCCAGAGCCGCGTGCGGGAGGGA No data
Right 1150790317 17:68197175-68197197 CGGGAGGGACGCAGGGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150790312 Original CRISPR TCCCTCCCGCACGCGGCTCT GGG (reversed) Intergenic