ID: 1150790625

View in Genome Browser
Species Human (GRCh38)
Location 17:68198283-68198305
Sequence GTCCAAGGGCCTCGGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150790625_1150790634 3 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790634 17:68198309-68198331 ACCGGGCAGGGACAGCCCGCAGG No data
1150790625_1150790640 21 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790640 17:68198327-68198349 GCAGGTAAAGCTGTTCTCCGGGG No data
1150790625_1150790630 -10 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790630 17:68198296-68198318 GCCCTTGGACTAAACCGGGCAGG No data
1150790625_1150790639 20 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790639 17:68198326-68198348 CGCAGGTAAAGCTGTTCTCCGGG No data
1150790625_1150790632 -9 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790632 17:68198297-68198319 CCCTTGGACTAAACCGGGCAGGG No data
1150790625_1150790638 19 Left 1150790625 17:68198283-68198305 CCCTCACACCGAGGCCCTTGGAC No data
Right 1150790638 17:68198325-68198347 CCGCAGGTAAAGCTGTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150790625 Original CRISPR GTCCAAGGGCCTCGGTGTGA GGG (reversed) Intergenic
No off target data available for this crispr