ID: 1150790854

View in Genome Browser
Species Human (GRCh38)
Location 17:68199341-68199363
Sequence CAGGCTGCTGCGCTGGGTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150790854_1150790863 10 Left 1150790854 17:68199341-68199363 CCGCGACCCAGCGCAGCAGCCTG No data
Right 1150790863 17:68199374-68199396 TGCCCGCCTGCCTGTACTTGCGG 0: 1
1: 1
2: 2
3: 20
4: 132
1150790854_1150790868 26 Left 1150790854 17:68199341-68199363 CCGCGACCCAGCGCAGCAGCCTG No data
Right 1150790868 17:68199390-68199412 CTTGCGGCCTGCGCAGTCCCTGG 0: 1
1: 0
2: 2
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150790854 Original CRISPR CAGGCTGCTGCGCTGGGTCG CGG (reversed) Intergenic
No off target data available for this crispr