ID: 1150797189

View in Genome Browser
Species Human (GRCh38)
Location 17:68247913-68247935
Sequence CCCCTGAGCGTGCGGCCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150797189_1150797202 17 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797202 17:68247953-68247975 GTGAGTTGGGCGGGGCCCACAGG 0: 1
1: 0
2: 1
3: 15
4: 197
1150797189_1150797203 18 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797203 17:68247954-68247976 TGAGTTGGGCGGGGCCCACAGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1150797189_1150797195 -9 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797195 17:68247927-68247949 GCTCAGGGGCGTGGCATGGGTGG 0: 1
1: 0
2: 2
3: 26
4: 288
1150797189_1150797197 3 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797197 17:68247939-68247961 GGCATGGGTGGGTCGTGAGTTGG 0: 1
1: 0
2: 0
3: 14
4: 159
1150797189_1150797196 -8 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797196 17:68247928-68247950 CTCAGGGGCGTGGCATGGGTGGG 0: 1
1: 0
2: 0
3: 28
4: 249
1150797189_1150797200 8 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797200 17:68247944-68247966 GGGTGGGTCGTGAGTTGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 230
1150797189_1150797201 9 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797201 17:68247945-68247967 GGTGGGTCGTGAGTTGGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 196
1150797189_1150797198 4 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797198 17:68247940-68247962 GCATGGGTGGGTCGTGAGTTGGG 0: 1
1: 0
2: 1
3: 7
4: 126
1150797189_1150797199 7 Left 1150797189 17:68247913-68247935 CCAGGCGGCCGCACGCTCAGGGG 0: 1
1: 0
2: 1
3: 12
4: 123
Right 1150797199 17:68247943-68247965 TGGGTGGGTCGTGAGTTGGGCGG 0: 1
1: 0
2: 10
3: 29
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150797189 Original CRISPR CCCCTGAGCGTGCGGCCGCC TGG (reversed) Exonic
906102993 1:43274955-43274977 CCCCTGAGCGTGGCACCTCCGGG - Intergenic
921556171 1:216601166-216601188 CCCCTGGCCGAGCGCCCGCCCGG - Intronic
922499074 1:226083594-226083616 CCCCTGTGCAGGCGGCCGCGTGG - Intergenic
924445172 1:244123156-244123178 CCCATGAGCATGCCGCCGGCAGG + Intergenic
924842909 1:247733061-247733083 CCCCTGAGACTGCGGCCCTCAGG + Intergenic
1063991071 10:11563843-11563865 CCCCTGAGCATGCAGCCCTCAGG + Intronic
1066489981 10:35884909-35884931 CTCCTGAGCGAGCGGCCACCTGG + Intergenic
1069856242 10:71442765-71442787 CCTCTGACCATGCGGCCACCTGG + Intronic
1070768419 10:79069289-79069311 CCCCGGAGCCAGCGGGCGCCTGG - Intronic
1071483650 10:86083300-86083322 TCCCTGAGTGTGTGGCCACCTGG + Intronic
1072089637 10:92115042-92115064 CCCCCGCGCCCGCGGCCGCCGGG - Intronic
1075082126 10:119391253-119391275 CCCCAGAGCTTGTGCCCGCCTGG - Intronic
1076354552 10:129842340-129842362 CCCCCGAGAGTGCGGCCAGCTGG - Intronic
1076504796 10:130964486-130964508 CCCCGGAGCATGGAGCCGCCAGG - Intergenic
1077293810 11:1814752-1814774 CCCCGGAGCTTGCAGCCTCCAGG - Intergenic
1077555086 11:3222116-3222138 CCCCTGATGGTGAGGCAGCCAGG - Intergenic
1079035232 11:17014539-17014561 CTCCTGAGGGAGCGACCGCCCGG + Intergenic
1083152195 11:60798821-60798843 CCCCTGGGCCTGCAGCCCCCTGG + Intronic
1083460048 11:62805234-62805256 CCCCGGGGCGTGAGGCCGCTAGG - Intronic
1084369960 11:68734830-68734852 CTGCTGAGCGTGCGGGCGCTCGG - Intronic
1084519651 11:69655545-69655567 CCCCTGAGGGTGGGGGCTCCGGG + Intronic
1085317569 11:75554771-75554793 ACCATCACCGTGCGGCCGCCTGG + Intergenic
1086430555 11:86732444-86732466 TCCCTGACGGTGCGGCTGCCGGG - Intergenic
1089622238 11:119728736-119728758 CCTCTGAGCCGGCGGCGGCCCGG - Exonic
1090261088 11:125320776-125320798 CCCTTAAGCGTGCTGCCTCCTGG + Intronic
1094704006 12:32896994-32897016 CCGCTGAGCGCGCGGACACCTGG + Intergenic
1103775576 12:123364533-123364555 CCCCGGAGCGCGCGGCCGCGAGG + Intronic
1104955233 12:132461596-132461618 GCCCTGAGTGAGGGGCCGCCAGG + Intergenic
1108594114 13:51935763-51935785 CCGCTGAGGGTGGGGCAGCCCGG - Intronic
1113543088 13:111123883-111123905 CCCCTGCCCCTGCGGCTGCCAGG + Intronic
1113848070 13:113403670-113403692 CCCCTGAGGGGGCGGCTTCCTGG + Intergenic
1116331666 14:43604514-43604536 CCCCTAAGCTTGAGGCCTCCTGG - Intergenic
1120788035 14:88554757-88554779 CCCATGAGCGCGCCGCGGCCCGG - Intergenic
1122406612 14:101504705-101504727 CCGCTGAGAGTGCGGCCGCGGGG + Intergenic
1122905795 14:104800887-104800909 GCCGCGAGCGGGCGGCCGCCCGG + Intronic
1122920488 14:104877972-104877994 CCCCTGAGCGTCCCTCCTCCTGG + Intronic
1125725917 15:41868092-41868114 CCTCAGAGAGTGCGGCCGCCTGG - Exonic
1127371853 15:58348951-58348973 CACCTGAGCCTGGGGCAGCCAGG - Intronic
1128068003 15:64776010-64776032 GCCCTAAGCGCGAGGCCGCCCGG - Intergenic
1129424647 15:75454747-75454769 CCCCCGACCGTGCCGCCGCCGGG - Intronic
1130543836 15:84840585-84840607 ACCCTGAGTGTCCGGGCGCCTGG + Exonic
1131495313 15:92904471-92904493 CCCCTCGGCGTGCGGCTCCCTGG - Intronic
1131605759 15:93900996-93901018 TCCCTGAGCATGCGCACGCCTGG + Intergenic
1132638123 16:963302-963324 TCCCTGCACGTGTGGCCGCCGGG - Intronic
1132648409 16:1009681-1009703 CCCCAGAGCCTGGGGCTGCCTGG - Intergenic
1132683721 16:1153777-1153799 CCCCTGGGCGCGCCGCCCCCTGG + Exonic
1134267835 16:12706949-12706971 CCCCTGAGAGAGAGGCCTCCTGG - Intronic
1138037741 16:53625405-53625427 CCCCAGACGGGGCGGCCGCCAGG - Intronic
1140112482 16:72015822-72015844 GCCCTGTGTGTGCGGCCTCCTGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142983621 17:3685454-3685476 TCCCTGCCAGTGCGGCCGCCGGG + Intronic
1146303367 17:31709489-31709511 GCCCTGAGCGTGCGTCCTCTGGG - Intergenic
1147150424 17:38510785-38510807 CCCCGGAGCCTGCGGGCGCGCGG + Exonic
1150797189 17:68247913-68247935 CCCCTGAGCGTGCGGCCGCCTGG - Exonic
1151797357 17:76355203-76355225 GCCCTGAGCCTGCAGCAGCCTGG + Intronic
1152686066 17:81694408-81694430 CCCCTGGGCCTGCAGCGGCCTGG - Intronic
1152718557 17:81911419-81911441 CCGCTGAGCGTGCGCCTGGCGGG - Intronic
1158658155 18:59359385-59359407 CTCCTGGCCGTGCGGCCGCGCGG - Exonic
1160501168 18:79401700-79401722 CCCATGAGAGTGTGGCCACCAGG + Intronic
1160841268 19:1147936-1147958 CCCCTGGGCGGGGGGCCCCCAGG - Intronic
1160860911 19:1236946-1236968 CCCCCGAGCGTAAGGCGGCCGGG - Intronic
1160919510 19:1513173-1513195 CCCCTGCGCTCGCGTCCGCCGGG - Exonic
1161078075 19:2296141-2296163 CCCCTGAGTGTGCTGTCGGCAGG - Intronic
1161221797 19:3121230-3121252 CCACGGAGCCTGCGGCTGCCGGG + Exonic
1163427037 19:17245580-17245602 CCCCCGGGCGAGCGGCGGCCAGG - Exonic
1164402566 19:27911800-27911822 CCTCTGTGCGTGCAGCTGCCAGG - Intergenic
1167108392 19:47444697-47444719 CCCCTGAGGGTGCGCCTGCCAGG - Intronic
1168073081 19:53963377-53963399 CCCGAGTGCGTGAGGCCGCCGGG - Exonic
1168588508 19:57614168-57614190 CCCCTAAGAGTGCCGCCGCCGGG - Intergenic
926212793 2:10883559-10883581 CCCCTGAGCCTGCTGACCCCAGG + Intergenic
933290361 2:80431576-80431598 CACCTGAGTGTGAGGCCACCTGG - Intronic
937688258 2:124722734-124722756 CCCCTGAGCCTGTGTCCTCCAGG + Intronic
943932107 2:193867922-193867944 ACCCTGAGTGTGCGGACACCTGG - Intergenic
946252761 2:218423661-218423683 CCCCTGAGCCTGCGACCTCCTGG + Intronic
947722655 2:232379128-232379150 CCACTGAGGGTCCGGGCGCCGGG - Intronic
947726999 2:232407214-232407236 CCACTGAGGGTCCGGGCGCCGGG - Intronic
948909986 2:240998218-240998240 GCCCTGAGCATGGGGACGCCAGG - Intergenic
1171866463 20:30489716-30489738 CCCCTCGGCGGGCGGCCGGCCGG + Intergenic
1175315669 20:58044915-58044937 CCCCTGAGGGTGCCTCCCCCAGG + Intergenic
1175390819 20:58626209-58626231 CCCCTGGGCTAGCGGCTGCCTGG - Intergenic
1175907177 20:62386685-62386707 CCCCTCACCCTGCGGCCACCTGG - Intergenic
1175940295 20:62534683-62534705 ACACTGAGTGTGTGGCCGCCAGG - Intergenic
1176665110 21:9679083-9679105 CCCCTGAGCCTGCACCCACCCGG + Intergenic
1180014673 21:45074510-45074532 CCCCTCGGCGTGCGCGCGCCCGG + Intronic
1181491361 22:23262666-23262688 CCGCTGGGTGTGGGGCCGCCGGG + Intronic
1184668074 22:45998914-45998936 CCCTTGACCGTGCAGCTGCCTGG + Intergenic
1184783815 22:46662279-46662301 GCCCTGAGCCTGCAGCCCCCTGG + Intronic
1185092539 22:48784134-48784156 TCCCTGAGCCTGCGGGGGCCTGG + Intronic
950438477 3:12994135-12994157 CCCCAGAGCGTCCGGTGGCCGGG + Intronic
953561191 3:43995163-43995185 CCGCGGAGGGTGGGGCCGCCCGG + Intergenic
954089349 3:48272226-48272248 CCCCCGAGCCTGCGCCCACCCGG + Intronic
962222473 3:133574522-133574544 CCCCGGAGGGTGGCGCCGCCCGG - Intronic
964376240 3:156051835-156051857 CCACTGAGCCTGCGCCCACCCGG - Intronic
970332833 4:15003040-15003062 CCCGCGATCGTGCCGCCGCCGGG - Exonic
974016885 4:56656150-56656172 CCGCTCAGCGTGCAGCCACCGGG - Intronic
976129592 4:81870587-81870609 CCTCTGAGCCTGCGGGAGCCAGG - Intronic
980328439 4:131379425-131379447 CCGCTGAGCCTGCGCCCACCAGG - Intergenic
982712187 4:158768886-158768908 GCCCGGGGCGGGCGGCCGCCGGG + Intergenic
985782266 5:1877606-1877628 CCCCTGGGCGTGAGGCCTCCTGG - Exonic
985825237 5:2186311-2186333 CCCCTGAGTGTGCGGCCTCCAGG - Intergenic
999372363 5:151063818-151063840 CCCCTAACCGTGCTGCCGCCTGG + Intronic
1004174577 6:13328568-13328590 CCTCTGCGCATGCGCCCGCCCGG - Intronic
1004811806 6:19270834-19270856 CCACTGAGCCTGCGCCCACCTGG - Intergenic
1006370027 6:33638434-33638456 CCCCTGAGGATGGGGCTGCCGGG - Intronic
1006386408 6:33733477-33733499 CCACTTAGCCTGCGGCTGCCCGG + Intronic
1016894332 6:149037592-149037614 CCCCTGTGCCTGCGGCGGCCTGG + Intronic
1018622743 6:165747695-165747717 CCCCAGAGGATGTGGCCGCCTGG + Intronic
1018737348 6:166697346-166697368 CCCCTGGGCATGCAGCCACCTGG + Intronic
1019485276 7:1286318-1286340 TCGCTGAGCCTGAGGCCGCCCGG - Intergenic
1019693963 7:2434152-2434174 TTTCTGAGCGTGCGGGCGCCGGG + Exonic
1019828339 7:3301642-3301664 CCCCTGAGCGCGCGGGCCCCGGG + Exonic
1028790605 7:94849460-94849482 TCCCGGAGAGTGCGGCGGCCGGG + Intergenic
1031213366 7:118858950-118858972 CCGCTGAGCCTGCGCCCACCCGG + Intergenic
1031447644 7:121873692-121873714 CCACGGAGCGGGCGGCCGCGCGG + Intronic
1034457902 7:151181371-151181393 CCCCTTTGCATGTGGCCGCCCGG - Exonic
1034567431 7:151926531-151926553 CCACTGAGGCTGCGGCCACCTGG - Intergenic
1034984299 7:155497691-155497713 CCTCTGCGCCTGCTGCCGCCTGG + Intronic
1035520442 8:272023-272045 CCCCAGAACCAGCGGCCGCCTGG - Intergenic
1040470069 8:47729486-47729508 CTACTGAGTGTGCGGCCCCCTGG - Intronic
1041068162 8:54101912-54101934 CGCCTGAGCGTGCGCCCGGTGGG - Exonic
1042336006 8:67630782-67630804 CCGCGGAGCCTGCGGCCACCCGG - Intronic
1044459672 8:92429532-92429554 CCCCTGAGCCCGCGTCCACCCGG + Intergenic
1048286475 8:133145755-133145777 CCCCTGAGGCTGTGGCCTCCAGG + Intergenic
1049342955 8:142123562-142123584 CCCCTGGGGGTGAGGCCGGCGGG - Intergenic
1049601223 8:143508681-143508703 CCCCTGAGCCTTGGGCTGCCAGG - Intronic
1049672009 8:143874051-143874073 CTGCTGAGCCTGCGGCCCCCGGG - Intronic
1050941909 9:11471386-11471408 CCCCTGAGCATGCGCACACCTGG - Intergenic
1051170468 9:14315052-14315074 CCGCGGAGCCTGCGGCTGCCGGG + Intronic
1051482952 9:17579128-17579150 CCTCTGGTCGTGCCGCCGCCGGG - Exonic
1052122767 9:24738585-24738607 CCACGGAGCCTGCGGCCACCCGG - Intergenic
1059264388 9:113012209-113012231 CGCCTGCGCACGCGGCCGCCAGG + Intergenic
1060971302 9:127739730-127739752 CCACTGTGCGGGCGGCCTCCAGG + Exonic
1062537790 9:137028416-137028438 ACCCTGCGCGCGCCGCCGCCGGG + Intronic
1203660991 Un_KI270753v1:42666-42688 CCCCTGAGCCTGCACCCACCCGG - Intergenic
1188460077 X:30415241-30415263 CCCATGAGCATACGGCCGGCAGG - Intergenic
1192177519 X:68895195-68895217 CGCCTGAGCCTGCACCCGCCTGG - Intergenic
1200082160 X:153583042-153583064 CCCCTGGGTGTGCAGCAGCCTGG + Intergenic