ID: 1150804863

View in Genome Browser
Species Human (GRCh38)
Location 17:68310740-68310762
Sequence AGATACGCGCCCTTGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150804858_1150804863 0 Left 1150804858 17:68310717-68310739 CCTAGAGCTTGATGCTTTTCCTG 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1150804863 17:68310740-68310762 AGATACGCGCCCTTGGTGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 52
1150804857_1150804863 10 Left 1150804857 17:68310707-68310729 CCACTTGCATCCTAGAGCTTGAT 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1150804863 17:68310740-68310762 AGATACGCGCCCTTGGTGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 52
1150804856_1150804863 24 Left 1150804856 17:68310693-68310715 CCACAGAGTTTTGGCCACTTGCA 0: 1
1: 1
2: 2
3: 10
4: 132
Right 1150804863 17:68310740-68310762 AGATACGCGCCCTTGGTGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150804863 Original CRISPR AGATACGCGCCCTTGGTGGG TGG Intronic
903711148 1:25325544-25325566 AGATGGGTGCCCTTGGGGGGTGG - Intronic
903715800 1:25365885-25365907 AGATGGGTGCCCTTGGGGGGTGG + Intronic
904010428 1:27386701-27386723 AGACAGACGCCATTGGTGGGAGG - Intergenic
907700600 1:56783898-56783920 AGATTCTTGCCCTTGCTGGGAGG + Intronic
911893893 1:103405061-103405083 AGATCCGACCCCTGGGTGGGAGG - Intergenic
912681257 1:111730390-111730412 AGATATGCGACATTTGTGGGAGG - Intronic
920430025 1:205912803-205912825 AGATACTCGTCCTGGGTGTGTGG + Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
924646350 1:245880992-245881014 AGATACTTGCCCTGGGTAGGCGG + Intronic
1064599961 10:16983824-16983846 AGGTACGAGCCCTTGGAGAGTGG + Intronic
1066140810 10:32502074-32502096 GGATACTCGACCTTGGTAGGGGG - Intronic
1068646965 10:59478911-59478933 AGATACAAGGGCTTGGTGGGGGG + Intergenic
1076704882 10:132295914-132295936 AGATAAGCCCCCTTGATGAGGGG + Intronic
1089594731 11:119570801-119570823 AGGTACGTGAACTTGGTGGGGGG + Intergenic
1095400803 12:41813335-41813357 AGTCACACTCCCTTGGTGGGTGG - Intergenic
1102993417 12:117330666-117330688 AGATCCACGGCTTTGGTGGGGGG + Exonic
1103899965 12:124298343-124298365 AGATACCCTGCCTTAGTGGGTGG - Intronic
1106422598 13:29595837-29595859 ACCGACGCGCCCTTGGTGGGCGG + Intergenic
1113306411 13:109083755-109083777 AGATAATTGCACTTGGTGGGTGG + Intronic
1114327290 14:21602110-21602132 AGATACGCACCACTGATGGGAGG - Intergenic
1114330686 14:21634126-21634148 AGATACGCACCACTGATGGGAGG - Exonic
1138629165 16:58279886-58279908 TGATACGCAGCCTGGGTGGGGGG - Exonic
1144787117 17:17838046-17838068 AGAGAAGCACCCTTGGTGGAGGG + Intergenic
1150804863 17:68310740-68310762 AGATACGCGCCCTTGGTGGGTGG + Intronic
1154331176 18:13430037-13430059 AGTGACGGGCTCTTGGTGGGTGG + Intronic
1163777250 19:19225689-19225711 TGACACTCGCCCTTGTTGGGGGG + Intronic
1165740771 19:38203933-38203955 ACAGAGGTGCCCTTGGTGGGTGG + Intronic
925872043 2:8279693-8279715 AGAAAAGCGCCCCAGGTGGGTGG - Intergenic
936972674 2:118189968-118189990 AAACACCAGCCCTTGGTGGGGGG - Intergenic
938916210 2:135942882-135942904 AGATTCTAGCCCTTGATGGGAGG - Intronic
942317557 2:174709643-174709665 ACATAGGAGCCCATGGTGGGCGG + Intergenic
1182940992 22:34277392-34277414 AGATACGCGCACTGGGAGGATGG - Intergenic
1185060969 22:48606779-48606801 GGAGACACGCTCTTGGTGGGAGG + Intronic
966291202 3:178361401-178361423 GGATGCTCGACCTTGGTGGGGGG + Intergenic
985928265 5:3034778-3034800 AGATGAGGGCCCTTGCTGGGTGG + Intergenic
998279209 5:140788466-140788488 ACATACGCACCCTCAGTGGGCGG - Exonic
1001639447 5:173234651-173234673 AGACACGCGCCCTTGGGCCGAGG - Intronic
1006876366 6:37300696-37300718 AGAGACTGGCCCTGGGTGGGGGG - Intronic
1019334649 7:477228-477250 AGACGCGCGCCCAGGGTGGGAGG - Intergenic
1030282324 7:107789842-107789864 AGAGAGGAGCCCTGGGTGGGAGG - Intronic
1030500815 7:110356629-110356651 AGATGCTCGAGCTTGGTGGGGGG - Intergenic
1034715111 7:153234838-153234860 AGACACTCGAGCTTGGTGGGTGG - Intergenic
1037190987 8:16125075-16125097 AAATACGAGCTTTTGGTGGGAGG + Intronic
1037502157 8:19496708-19496730 AGATATGAGCCCTTGCTTGGTGG + Intronic
1040520091 8:48169214-48169236 GGATACTCGACCTTGGTGGGGGG - Intergenic
1051857154 9:21581618-21581640 AGATACGTGCGCATGTTGGGAGG - Intergenic
1056579050 9:87877040-87877062 AGAGACGCGCTCTCCGTGGGAGG + Intergenic
1057045576 9:91883885-91883907 AGATAGGGGCCCTGGGTAGGGGG - Intronic
1191256127 X:58280373-58280395 AGACACACACCCTGGGTGGGAGG + Intergenic
1192085284 X:68090221-68090243 AGACACACACACTTGGTGGGGGG - Intronic
1194643401 X:96429424-96429446 AGATGCTCGAGCTTGGTGGGGGG - Intergenic
1195344951 X:103940505-103940527 AGATGCTCGATCTTGGTGGGGGG - Intronic
1196399710 X:115300945-115300967 AAATTCGCGTCCTTGCTGGGGGG + Intronic
1197880749 X:131164257-131164279 AGACACTCGAGCTTGGTGGGGGG - Intergenic
1199436606 X:147819667-147819689 AGATGCTCGAGCTTGGTGGGGGG + Intergenic