ID: 1150804930

View in Genome Browser
Species Human (GRCh38)
Location 17:68311236-68311258
Sequence CCCATCACACAGATGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150804930 Original CRISPR CCCATCACACAGATGAAGGG AGG (reversed) Intronic
900206140 1:1432679-1432701 CCCAGCACACAGACGAGGGATGG + Intergenic
902630519 1:17701828-17701850 CCCATCCCTCAGATGGAGGTGGG + Intergenic
902919368 1:19657095-19657117 CCCCCCACACAGAGGAAGAGGGG + Exonic
905828504 1:41045743-41045765 CCCAGGACACAGAACAAGGGAGG - Intronic
905861184 1:41352965-41352987 CCCATTTCACAGATGAAAAGGGG - Intergenic
910108487 1:83656841-83656863 CCCATGTCCCAGATGAAGGATGG + Intergenic
912300481 1:108510837-108510859 CCCATCTTACAGACAAAGGGTGG - Intergenic
912850438 1:113119502-113119524 CCCTCCACACAGATGAGCGGTGG + Exonic
913078419 1:115360370-115360392 CCCACCTCCCAGACGAAGGGCGG + Intergenic
915272849 1:154767459-154767481 CCCATAACATTGATGAAGTGGGG - Intronic
915340994 1:155176698-155176720 CCAATGAGAGAGATGAAGGGAGG + Intronic
915992676 1:160532400-160532422 CTCACCTCCCAGATGAAGGGCGG - Intergenic
916844202 1:168631775-168631797 ACCAGCACACAGATGATGGTAGG - Intergenic
920843935 1:209577785-209577807 CAAATCACACACATGAAGAGAGG + Intergenic
924123589 1:240827273-240827295 CCAATGACACAAATCAAGGGAGG + Intronic
924459797 1:244248842-244248864 CCCTTTTCACAGATAAAGGGAGG + Intergenic
1063022560 10:2144290-2144312 CCCAACACACACATGAAGAAGGG + Intergenic
1066129307 10:32375650-32375672 CCCATCCCTCTGATGGAGGGAGG - Intronic
1067088338 10:43254345-43254367 CCCACCACACAGATCTAAGGGGG - Intronic
1067100347 10:43329861-43329883 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1067120115 10:43465572-43465594 CCCACAACTCAGATGATGGGCGG + Intronic
1067334094 10:45347251-45347273 CCCACCTCCCAGACGAAGGGTGG - Intergenic
1067334107 10:45347290-45347312 CCCACCTCCCAGATGAAGGGCGG - Intergenic
1067334324 10:45348086-45348108 CCCACCTCCCAGACGAAGGGTGG - Intergenic
1067334337 10:45348125-45348147 CCCACCTCCCAGATGAAGGGCGG - Intergenic
1068818810 10:61349258-61349280 CCTATCACATAGATGTAGTGAGG + Intergenic
1069674593 10:70238744-70238766 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1070458442 10:76641546-76641568 CCCATCAAACAGAAGACAGGAGG - Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071482201 10:86073374-86073396 CCCAGCACACAGATGAAGTCTGG - Intronic
1071536862 10:86440629-86440651 CCCATCACACACAGGAAAGGAGG - Intronic
1073417357 10:103395633-103395655 CCCATCTCACAGGTGGAGAGAGG - Intronic
1074050572 10:109877673-109877695 CTCAACAGACAGATGAAGGTGGG + Intronic
1075815261 10:125260154-125260176 TCCATCCTATAGATGAAGGGAGG + Intergenic
1076851880 10:133097267-133097289 CCCATCACACAGCCGAAGGGTGG + Intronic
1081595292 11:44454635-44454657 GCCACCCCACAGGTGAAGGGGGG - Intergenic
1081692460 11:45087681-45087703 GCCAACACACAGAAGAAGAGTGG - Intergenic
1083632287 11:64101986-64102008 CCCAGCACCCAGATGGGGGGTGG - Intronic
1084334043 11:68446602-68446624 CCCATGCCACTGATGAGGGGAGG + Intronic
1084602701 11:70155619-70155641 CCCATCTCACAGATGGTGGCTGG - Intronic
1087388394 11:97503597-97503619 CTCAACAGACAGATGAAGAGGGG + Intergenic
1089135581 11:116246471-116246493 CCCTGCACACAAATGAAGAGAGG + Intergenic
1089932112 11:122323352-122323374 TCCATAACCCAGATGAAGGGAGG - Intergenic
1090070028 11:123536004-123536026 CCCGCCACATAGCTGAAGGGAGG - Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1096242393 12:49966361-49966383 CCCATTTTACAGATGAAGAGAGG - Intergenic
1096945439 12:55402433-55402455 ACCATCAAATAGATGAAGGTAGG + Intergenic
1097626798 12:62010795-62010817 CCCACCTCCCAGATGAAGGGTGG - Intronic
1097626822 12:62010873-62010895 CCCACCTCCCAGACGAAGGGCGG - Intronic
1097626835 12:62010912-62010934 CCCACCTCCCAGACGAAGGGCGG - Intronic
1097626848 12:62010951-62010973 CCCACCTCCCAGACGAAGGGCGG - Intronic
1102705954 12:114880626-114880648 CCCATCTTACAGATGAAGAAAGG + Intergenic
1103350124 12:120278217-120278239 CCCACCTCCCAGATGAAGGGCGG + Intergenic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1103906160 12:124328188-124328210 CCCATCACACAGGTGGAGGTGGG - Intronic
1105698868 13:22919042-22919064 ACCATCACACAGAAGGAGGAGGG - Intergenic
1105892952 13:24695171-24695193 ACCATCACACAGAGGGAGTGCGG + Intronic
1106275985 13:28207033-28207055 CCCCTCTCACAGAGGCAGGGCGG + Intronic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1106782452 13:33072978-33073000 GCAAGCACCCAGATGAAGGGTGG - Intergenic
1110577097 13:77070044-77070066 GCCAACACACAGAAGAATGGGGG + Intronic
1110981207 13:81900921-81900943 CCAATTAAACAGATGAAAGGTGG + Intergenic
1112157363 13:96832579-96832601 TCCATCACACATATGAAGAGAGG - Exonic
1113391092 13:109897865-109897887 GCCATCCCACAGTGGAAGGGTGG - Intergenic
1113471044 13:110546579-110546601 CCTGTCACACAGACCAAGGGTGG - Intronic
1116502125 14:45635159-45635181 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1116502215 14:45635456-45635478 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1119320547 14:73727485-73727507 CCCATCACAGAGAGGACAGGCGG + Exonic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1122084335 14:99289440-99289462 CCCATCACACTGAAGAAGCATGG + Intergenic
1122273531 14:100579400-100579422 CCCTTCACACAAATGATGGAGGG - Intronic
1122364131 14:101184102-101184124 CCCATCACCCATGTGAAGAGAGG - Intergenic
1122809216 14:104279750-104279772 CCCATGTCACAGATGAAACGGGG - Intergenic
1125031863 15:35082293-35082315 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1126419275 15:48454622-48454644 CCTATAACACAGGTGAAGGTTGG + Intronic
1127641134 15:60916981-60917003 CCCATCGCACTGGTGATGGGAGG + Intronic
1128664389 15:69527638-69527660 CCAAGCACACAGATCTAGGGAGG + Intergenic
1128994216 15:72285012-72285034 CCCATCTCACAGAAGCAGGCAGG + Exonic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129873216 15:78955011-78955033 CCCATGACCCAGCTGAAGAGTGG - Intergenic
1130613210 15:85380266-85380288 ACCAGTACACAGAGGAAGGGCGG + Intergenic
1131254684 15:90854373-90854395 CCCATCACACAGGTGATGTGGGG - Intergenic
1133833923 16:9350444-9350466 CCCACCTCCCAGACGAAGGGCGG + Intergenic
1133833956 16:9350554-9350576 CCCACCTCCCAGACGAAGGGCGG + Intergenic
1136931450 16:34421654-34421676 CCCATCACCCAGATGATGTCTGG + Intergenic
1136973123 16:34990165-34990187 CCCATCACCCAGATGATGTCTGG - Intergenic
1138307400 16:55989665-55989687 CCCGCCTCCCAGATGAAGGGTGG - Intergenic
1141811664 16:86380158-86380180 CCCATCAGAAAGAGGAAGGAGGG + Intergenic
1141825891 16:86480146-86480168 CCCATCTCAGAGAGGGAGGGAGG - Intergenic
1145366668 17:22271277-22271299 CCCATCACATAGTTGTGGGGGGG - Intergenic
1145771340 17:27495406-27495428 CCCCTCACACAGAGGAGGTGAGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147439791 17:40441064-40441086 TCCATCTCATAGATGAAGTGGGG - Intergenic
1150804930 17:68311236-68311258 CCCATCACACAGATGAAGGGAGG - Intronic
1151602655 17:75115799-75115821 CCCATCTGACAGATGATTGGAGG - Intronic
1153641299 18:7159713-7159735 CACATCTCACAAATAAAGGGGGG - Intergenic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1163744859 19:19040026-19040048 GCTATCACACAGCTGAAGTGTGG - Intronic
1164016616 19:21260363-21260385 CTCACCTCCCAGATGAAGGGCGG + Intronic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1167704146 19:51068502-51068524 CCCAACGCAAACATGAAGGGAGG + Intergenic
1167793344 19:51693754-51693776 CCCAGGACACTGATGAAGTGTGG - Intergenic
925736111 2:6965346-6965368 CCCACCACACATGTGAAGGCAGG + Intronic
926375153 2:12219886-12219908 CCCATAACACAGATTCAAGGAGG - Intergenic
926437166 2:12849890-12849912 CTCATCACACCGAAGAAGGCTGG + Intergenic
926473897 2:13298037-13298059 CCCATCTCACAGATGGAAGTGGG + Intergenic
926798477 2:16638379-16638401 CCCATCACACAGGTGGAGTCCGG - Intronic
927737246 2:25534914-25534936 CCCACCTCCCAGATGAAGAGCGG + Intronic
927994134 2:27470811-27470833 TCTATCACAGAGATTAAGGGTGG + Intronic
928022252 2:27714442-27714464 CCCATTGCACAGATGAAGTTGGG + Intronic
929078660 2:38099807-38099829 CACATGACACAGAGGATGGGTGG - Intronic
930518073 2:52432590-52432612 TCTTTAACACAGATGAAGGGAGG + Intergenic
930737550 2:54794879-54794901 GCCATCATACAGATGAGGGCTGG - Intronic
932205553 2:69878294-69878316 CAAATCACCCAGATGAAGGTCGG - Intronic
935251483 2:101265763-101265785 CCCATCACACAGCTGGATCGTGG + Intronic
937990063 2:127657233-127657255 CACATCTCACAGGTGAAGGATGG + Intronic
939008967 2:136822534-136822556 CCCATTTTACAGATGAAGGAAGG + Intronic
943418351 2:187636854-187636876 CCCACCTCCCAGATGAAGGGCGG + Intergenic
943418397 2:187637001-187637023 CCCACCTCCCAGACGAAGGGCGG + Intergenic
944870693 2:203908862-203908884 CCCATTTCACAGATGAAGACTGG - Intergenic
945932111 2:215865713-215865735 CCCATCGAAGAGAGGAAGGGTGG + Intergenic
945985678 2:216351761-216351783 CTCATCTCAAAGATGAAGGAAGG + Intronic
946183270 2:217961564-217961586 CCCATCTTACAAATGAAAGGAGG + Intronic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
947701897 2:232241315-232241337 TTCATCACACAGGGGAAGGGGGG + Intronic
1168936871 20:1673309-1673331 CCCCTCACAGGGATGGAGGGGGG - Intergenic
1168969348 20:1920131-1920153 CCCCTCACAGAGATGGAGTGAGG + Intronic
1169475071 20:5923667-5923689 CCCATCACACAGCTGAAAAGAGG + Exonic
1171804071 20:29658669-29658691 CCCAAGACACAGAAGAAGGCAGG + Intergenic
1172188747 20:33048970-33048992 CCCATGCCACAGAGGAAGGAGGG + Intergenic
1173342006 20:42161383-42161405 CACATCACGCAGATGAAGAGAGG - Exonic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1175447225 20:59031654-59031676 CCCCTCACAAAGATGAGAGGTGG - Intronic
1175597367 20:60246180-60246202 CCCACCACACAGGTCCAGGGTGG - Intergenic
1178924390 21:36762675-36762697 CCCATCACACAGGTGAGGCTGGG + Intronic
1180210275 21:46291635-46291657 CCCATGCCACAGTTGAAGGAGGG + Intronic
1180861235 22:19084291-19084313 CCCATATCTCAGATGATGGGCGG - Intronic
1181362315 22:22347367-22347389 CCCAGGACACAGAGGAAGAGGGG - Intergenic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1182778557 22:32849517-32849539 ACCATCAAGCAGATGAAGGTAGG + Exonic
1183724062 22:39578690-39578712 ATCAGCACACAAATGAAGGGAGG - Intronic
949369592 3:3319743-3319765 CACATTACACAGATGTAAGGAGG - Intergenic
950527208 3:13531482-13531504 CCCATCACACAGAAGTAGCAAGG - Intergenic
953307122 3:41841235-41841257 CCCACCTCCCAGATGAAGGGCGG - Intronic
953307213 3:41841529-41841551 CCCACCTCCCAGACGAAGGGCGG - Intronic
956741723 3:72280737-72280759 CCCATTTTACAGATGAAGAGAGG + Intergenic
957611671 3:82474499-82474521 CCTAAAACACAGATGAAAGGTGG + Intergenic
958406087 3:93760673-93760695 TCCACCTCCCAGATGAAGGGCGG + Intergenic
958406255 3:93761280-93761302 CCCACCTCCCAGATGAAGGGTGG + Intergenic
958406507 3:93762109-93762131 CCCACTTCCCAGATGAAGGGCGG + Intergenic
958406675 3:93762748-93762770 CCCACCTCCCAGATGAAGGGCGG + Intergenic
958406861 3:93763384-93763406 CCCACCTCCCAGAAGAAGGGTGG + Intergenic
963129453 3:141844987-141845009 ACCATCACACAGAATATGGGTGG - Intergenic
966202421 3:177370911-177370933 GCCATCACACAGAAGGAGGAGGG - Intergenic
967447513 3:189584192-189584214 TCTATCACACAGAGGAAGGAAGG + Intergenic
970216381 4:13763124-13763146 TCCATTTCACAGATGAAGTGAGG - Intergenic
972186668 4:36536649-36536671 CCCATATCACAAATGAAGGAGGG - Intergenic
972700717 4:41491405-41491427 CCCACCTCCCAGATGAAGGGCGG + Intronic
973021395 4:45208318-45208340 CTCACCTCCCAGATGAAGGGCGG - Intergenic
973613225 4:52657174-52657196 ACCATCACCCAGATGAAGTGAGG - Intronic
974273946 4:59690530-59690552 TCCATTACACAGATGATGGAAGG + Intergenic
974848739 4:67381280-67381302 CTCACCTCCCAGATGAAGGGTGG - Intergenic
975439070 4:74389508-74389530 TCCATCACTGTGATGAAGGGTGG - Intergenic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
978593759 4:110354910-110354932 CCCACCACACAGAAGAATGTAGG - Intergenic
979916365 4:126439518-126439540 GCCATCAAACAGTTGGAGGGAGG + Intergenic
981902749 4:149886101-149886123 CCCATCAAAGAGATTAAGGCAGG + Intergenic
982709765 4:158746901-158746923 CCCATATCTCAGATGATGGGTGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984542361 4:181055629-181055651 TCCCTCACATAGCTGAAGGGTGG + Intergenic
985540810 5:486596-486618 CCCATGACAGAGGTGAAGGGAGG - Intronic
986117876 5:4797964-4797986 GCCTTCACACAGGTGAAGTGGGG + Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
988853358 5:35200851-35200873 AAGATCACACAGATGAACGGAGG + Intronic
989977872 5:50607921-50607943 CCCACCTCCCAGAGGAAGGGTGG - Intergenic
990709182 5:58563553-58563575 CCCACCTCCCAGATGAAGGGTGG + Intergenic
990709262 5:58563819-58563841 CCCACCTCCCAGATGAAGGGCGG + Intergenic
990709295 5:58563934-58563956 CCCACCTCCCAGACGAAGGGCGG + Intergenic
992508099 5:77407446-77407468 CCCATCACAAAGGTGAGTGGCGG + Exonic
997626403 5:135334094-135334116 CCCGTTCCACAGATGAAGGAGGG - Exonic
1002937810 6:1688325-1688347 CCCATTACACAGATGAACGACGG + Intronic
1004276276 6:14238128-14238150 CTCCACACACAGATGAAGAGGGG - Intergenic
1005963970 6:30713342-30713364 CCCTTCACAGTGATGAAGAGGGG - Exonic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1008965595 6:57310961-57310983 CCCACCTCCCAGACGAAGGGCGG + Intergenic
1009698811 6:67147109-67147131 CTCATCACACACATGAAAGGGGG - Intergenic
1009869079 6:69432993-69433015 CCCATCTCCCAGATGAAGGGTGG + Intergenic
1010010828 6:71046315-71046337 CCCATCACCCAGATGCTGAGCGG + Intergenic
1012022860 6:93947293-93947315 CACATCCCACCCATGAAGGGTGG + Intergenic
1012235876 6:96814528-96814550 CCAATCACACAGCTGGTGGGAGG + Intronic
1017855668 6:158348932-158348954 CTCACCTCCCAGATGAAGGGCGG + Intronic
1018882097 6:167894246-167894268 CCTATTCTACAGATGAAGGGAGG - Intronic
1019576084 7:1738247-1738269 CCCCTCACCCAGATGGAGAGAGG - Intronic
1021018248 7:15563272-15563294 CACAACACACAGGTGAAGTGAGG + Intergenic
1024581572 7:50805101-50805123 CCCATCTCACAGATGAGGAAAGG - Intergenic
1026185835 7:68082146-68082168 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185885 7:68082330-68082352 CTCACCTCCCAGATGAAGGGCGG - Intergenic
1026185906 7:68082406-68082428 CTCACCTCCCAGATGAAGGGTGG - Intergenic
1027633485 7:80638794-80638816 CCCATCACCCAGATGACGGGAGG + Intronic
1028199518 7:87944774-87944796 CCTAAGACACAGATCAAGGGTGG - Intronic
1028892696 7:96006168-96006190 CCCATTACACATATTAAGTGGGG - Intronic
1030199296 7:106886227-106886249 CCCATCACAAAGAGGAAGTCAGG - Exonic
1032072632 7:128818185-128818207 GCCATCACACAGAGGATGAGCGG - Intronic
1038193462 8:25345229-25345251 CCCTTCTCACAGGTGAAGGTGGG - Intronic
1039428339 8:37505491-37505513 CACATCCCACAGAAGGAGGGAGG + Intergenic
1039941829 8:42097914-42097936 CCCAACCCACAGAAGATGGGTGG - Intergenic
1040916856 8:52573149-52573171 CTCACCTCCCAGATGAAGGGCGG + Intergenic
1041392128 8:57356299-57356321 CCCATCTCACAGCTGAGAGGTGG + Intergenic
1043270506 8:78327547-78327569 CCACCCACACGGATGAAGGGCGG - Intergenic
1044582011 8:93833792-93833814 CCCACCTCCCAGATGAAGGGCGG + Intergenic
1044582061 8:93833942-93833964 CCCACCTCCCAGATGAAGGGTGG + Intergenic
1046803278 8:118452086-118452108 TCCACCACACAGAGGGAGGGTGG + Intronic
1047205115 8:122796955-122796977 CCCATCAGGCAGATGCAGGCCGG + Intronic
1048637673 8:136315881-136315903 CCAATCATACAGATGAACGAGGG + Intergenic
1049551923 8:143264011-143264033 CCCATCACAGAGAGGCAGGAGGG - Intronic
1050417870 9:5434257-5434279 CCCACCTCCCAGACGAAGGGCGG - Intronic
1052259235 9:26493178-26493200 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1052259295 9:26493362-26493384 CCCACCTCCCAGATGAAGGGTGG - Intergenic
1053081681 9:35183226-35183248 CCCACCTCCCAGACGAAGGGCGG + Intronic
1053081752 9:35183413-35183435 CCAACCTCCCAGATGAAGGGCGG + Intronic
1053081792 9:35183526-35183548 CCAACCTCCCAGATGAAGGGCGG + Intronic
1053453240 9:38210949-38210971 CCCACCACACAGAGAAAGGAAGG + Intergenic
1054950992 9:70851725-70851747 CCCATCTTACAGATGAAGAAAGG + Intronic
1056229277 9:84527148-84527170 CCCACCTCCCAGACGAAGGGTGG + Intergenic
1056674818 9:88666281-88666303 CCAACCAGACAGATGGAGGGTGG - Intergenic
1057141177 9:92727648-92727670 CCCATCACCAAGATGGAGGTGGG - Intronic
1057854745 9:98593749-98593771 GCCTGCTCACAGATGAAGGGGGG + Intronic
1058070084 9:100592756-100592778 CCCAGCCCAGAGATGAAGGCTGG + Intergenic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1060430295 9:123545419-123545441 CCCAGCACACAGTTGATGGAGGG - Intronic
1060682991 9:125582273-125582295 CTCACCAAACAGATGAAGGAAGG - Intronic
1061536623 9:131254316-131254338 TCAATCAGACAGAAGAAGGGTGG - Intergenic
1061721806 9:132556592-132556614 CCCATCACACAGAGGGAGAGGGG + Intronic
1062387508 9:136318836-136318858 TCCATCAGACAGACGCAGGGCGG + Intergenic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1187844554 X:23523048-23523070 CCCACCTCCCAGACGAAGGGTGG - Intergenic
1192505068 X:71676404-71676426 CCCACCTCCCAGACGAAGGGCGG - Intergenic
1192564084 X:72148367-72148389 CCCATAACAGAGATGAAGCAGGG - Intergenic
1192585587 X:72316011-72316033 CACATCTTACAGATGAAGGGAGG + Intergenic
1192663826 X:73068779-73068801 CCCACCTCTCAGATGAAGGGGGG - Intergenic
1192664010 X:73069327-73069349 CCCACCTCCCAGATAAAGGGGGG - Intergenic
1192664090 X:73069591-73069613 CCCACCTCCCAGATGAAGGGCGG - Intergenic
1192885778 X:75335094-75335116 CCCACCTCCCAGATGAAGGGCGG + Intergenic
1192885878 X:75335388-75335410 CCCACCTGCCAGATGAAGGGCGG + Intergenic
1193156074 X:78175760-78175782 CCCACCACCCAGATTAAGGGTGG + Intergenic
1195940010 X:110160099-110160121 CACATCACAAGGATGAAGAGAGG - Intronic
1198545010 X:137682300-137682322 CCCAGCAGACAGAAGAAAGGAGG - Intergenic
1198678389 X:139155494-139155516 CCCAACACTCAGATGACAGGTGG + Intronic
1199538017 X:148925695-148925717 CCCATTACACAGATGAGGGAAGG - Intronic