ID: 1150806624

View in Genome Browser
Species Human (GRCh38)
Location 17:68324485-68324507
Sequence CTTTCCACTACAGCCACGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150806624_1150806633 8 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806633 17:68324516-68324538 AATTTGGGTTGGAAAGGCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 182
1150806624_1150806629 -7 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806629 17:68324501-68324523 TGGAAAGGGCATAGGAATTTGGG 0: 1
1: 0
2: 4
3: 35
4: 280
1150806624_1150806631 2 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806631 17:68324510-68324532 CATAGGAATTTGGGTTGGAAAGG 0: 1
1: 0
2: 4
3: 40
4: 249
1150806624_1150806628 -8 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806628 17:68324500-68324522 GTGGAAAGGGCATAGGAATTTGG 0: 1
1: 0
2: 3
3: 60
4: 374
1150806624_1150806630 -3 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806630 17:68324505-68324527 AAGGGCATAGGAATTTGGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 259
1150806624_1150806634 20 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806634 17:68324528-68324550 AAAGGCCTGGGTTCAAATTCTGG 0: 1
1: 5
2: 53
3: 288
4: 1318
1150806624_1150806632 7 Left 1150806624 17:68324485-68324507 CCTCGCGTGGCTGTAGTGGAAAG 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1150806632 17:68324515-68324537 GAATTTGGGTTGGAAAGGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150806624 Original CRISPR CTTTCCACTACAGCCACGCG AGG (reversed) Intronic