ID: 1150807167

View in Genome Browser
Species Human (GRCh38)
Location 17:68328640-68328662
Sequence ACCAGGAGCTTGTAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150807162_1150807167 10 Left 1150807162 17:68328607-68328629 CCCAGCTAGCTCTGTCGTGGTTG 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 190
1150807163_1150807167 9 Left 1150807163 17:68328608-68328630 CCAGCTAGCTCTGTCGTGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 190
1150807161_1150807167 11 Left 1150807161 17:68328606-68328628 CCCCAGCTAGCTCTGTCGTGGTT 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG 0: 1
1: 0
2: 2
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150807167 Original CRISPR ACCAGGAGCTTGTAGGTGAA AGG Intronic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
901965559 1:12863252-12863274 TCCAGGAGCTTGCAGGCTAACGG - Intronic
903218334 1:21855174-21855196 ACCACCATCTTGGAGGTGAAGGG + Intronic
904940052 1:34159340-34159362 CCCAGGAGCTTGTGGTGGAAAGG + Intronic
906395283 1:45457955-45457977 ACCAGGAACTAGAATGTGAAAGG - Intronic
906571070 1:46841060-46841082 ACCAGAAGGTTGCAGGTGTATGG + Intergenic
908077771 1:60539895-60539917 GCCAGGAGCTAGGAGCTGAAAGG - Intergenic
910346806 1:86248205-86248227 ACCAAAAGCTTTTAGTTGAAAGG - Intergenic
911587081 1:99703864-99703886 ACCAGGAGCTGGTGGGAGAAAGG - Intergenic
913394003 1:118346281-118346303 ACTAGGAGCTAGTGGGTGGATGG + Intergenic
913990227 1:143605080-143605102 ACCAGGAGATTGTAGATTTAGGG - Intergenic
914831537 1:151174291-151174313 ACTAGGAGCTGGAAGGTGAGAGG + Intronic
915112951 1:153576102-153576124 ACCAGAGGCTAGTTGGTGAATGG - Intergenic
915901908 1:159853720-159853742 ACCAGCAGCATCTAGGTGAAGGG + Intronic
916764434 1:167846671-167846693 ACCAGGAGTTTCTAGGAGAAAGG - Intronic
918931573 1:190861783-190861805 AGCAGGAGCTTGAGAGTGAATGG - Intergenic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
923488833 1:234464119-234464141 ATCAGGAACTTGTAGGAAAATGG + Intronic
924171581 1:241347534-241347556 ACCAGAAGCTTCTGGGTAAAAGG - Intronic
924630084 1:245729221-245729243 ATCAGATGGTTGTAGGTGAACGG - Intergenic
924929992 1:248721958-248721980 GACAGCAGCTGGTAGGTGAAGGG + Intronic
1066177438 10:32923505-32923527 ACTAAGAGCTTGTGGGTGACTGG - Intronic
1067105271 10:43362288-43362310 AGCAGGGGCTTGCAGGTGAGTGG + Intergenic
1069088230 10:64167255-64167277 ACCAAGAGCTTGAAGGTGAGGGG - Intergenic
1069834283 10:71299042-71299064 CCCCGGAGCCTGGAGGTGAAGGG - Intronic
1070312651 10:75284663-75284685 ACCATCAGCTTGAAGGTGAAGGG - Intergenic
1072415561 10:95243934-95243956 ACCAGGAGCTGGAAGGAGAGAGG + Intronic
1073057914 10:100713974-100713996 GCCAGGAGCGTGCAGGTGAGGGG - Intergenic
1073739047 10:106385104-106385126 ACTATAAGCTTGTAAGTGAATGG - Intergenic
1074380318 10:112973965-112973987 AACAGGTGCATGGAGGTGAATGG + Intronic
1076368011 10:129934660-129934682 AGCAGGAGCTTGTGAGGGAATGG - Intronic
1077668880 11:4139162-4139184 ACCAGGGACTTGGAGGGGAAAGG - Intergenic
1078719855 11:13874553-13874575 ACCAGAAGCTGGGAAGTGAAGGG - Intergenic
1081713027 11:45230046-45230068 ACCAAGACCATGGAGGTGAAGGG - Intronic
1083728772 11:64642379-64642401 AGCTGGAGATTGGAGGTGAAGGG + Intronic
1088481962 11:110302857-110302879 ACCAGGAGGTTGAAGCTGCAGGG + Intergenic
1089200493 11:116721970-116721992 ACCAGCAGCTGGTAAGTAAAGGG + Intergenic
1090279082 11:125440891-125440913 TCCAGGACCTTGGAGGAGAAAGG - Intergenic
1091642795 12:2250288-2250310 TCCAGGTGCTGGGAGGTGAACGG - Intronic
1091678071 12:2505785-2505807 ACCAGGAGCATTTAGGTGTTAGG - Intronic
1093502112 12:19825119-19825141 ACCAGATGGTTGTAGGTGTACGG - Intergenic
1094108715 12:26839006-26839028 GCCAGGCTCTTGTAGGTGAGAGG + Intergenic
1097261666 12:57723973-57723995 TCCAGGGTCTTGGAGGTGAAGGG + Intronic
1097957154 12:65497594-65497616 AAGAAGAGCTTGTAGGTAAAGGG - Intergenic
1099773325 12:87092836-87092858 ACCAGGAGCTAAGAGGGGAAAGG - Intergenic
1101018170 12:100524254-100524276 AGCAGCAGTTTGGAGGTGAAAGG + Intronic
1101566902 12:105915127-105915149 ACCAAGGTCTTGAAGGTGAAGGG - Intergenic
1102352710 12:112206182-112206204 CCCAGGACGTTGTGGGTGAAAGG + Intronic
1103905533 12:124325553-124325575 ATCAGGGGGTTGTAGGGGAATGG + Exonic
1104779221 12:131409095-131409117 CCCAGGAGCAGGAAGGTGAAGGG - Intergenic
1106032452 13:26015683-26015705 AACAGAATCGTGTAGGTGAAAGG - Intronic
1107125557 13:36841890-36841912 GGCAGGAGCTTGGAGGTAAAGGG - Intergenic
1107247859 13:38319333-38319355 ATCAGGTGGTTGTAGGTGTACGG + Intergenic
1107497064 13:40936868-40936890 ACCAGGAGCTGGGAGGTGAAGGG + Intronic
1113126571 13:106985929-106985951 ACCAGGAGCTAGTTGTTGAAAGG - Intergenic
1115214673 14:31002823-31002845 TCCAGGAGCTAGGAGGTGGAGGG + Intronic
1118456399 14:65948784-65948806 ACCAGGTGCTTGCAGAAGAAAGG - Intergenic
1118470318 14:66069145-66069167 ACCAGTAGGTGGTAGGAGAAGGG + Intergenic
1122538819 14:102485129-102485151 ACCAGAACCGTGGAGGTGAAGGG - Intronic
1123989326 15:25671842-25671864 GCCAGGAGCTGGAAGGGGAAAGG - Intergenic
1127845128 15:62863795-62863817 ACCAGATGGTTGTAGGTGTATGG - Intergenic
1127964744 15:63915289-63915311 TCTAGGAGCTTGGAGGTGCAAGG - Intronic
1128581522 15:68813770-68813792 GCCGGGAGCTTGTTGGTGATTGG - Intronic
1128802462 15:70505356-70505378 AGCAGGAGCTAGAAGGTAAAGGG - Intergenic
1132599132 16:766190-766212 TCCAGCTGCTCGTAGGTGAAGGG - Exonic
1136169874 16:28482465-28482487 ACCAGGGACTTGTAAGTGAGGGG - Exonic
1136288894 16:29259986-29260008 GCCAGGAGCTGGGAGGTGGAGGG + Intergenic
1136503725 16:30688987-30689009 ACCAGGAGACTGCAGGGGAAGGG - Intergenic
1140724236 16:77797724-77797746 CCCAGGAGCTTGGAGGTCATCGG - Intronic
1141297397 16:82782818-82782840 GCCAGGAACTTGGAGCTGAAAGG - Intronic
1142023488 16:87799439-87799461 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
1142094622 16:88232893-88232915 GCCAGGAGCTGGGAGGTGGAGGG + Intergenic
1145938725 17:28729883-28729905 ACCAGTAGTCTGCAGGTGAAGGG + Intronic
1148206179 17:45781646-45781668 GCCAGGCCCTTGAAGGTGAAAGG + Intergenic
1149102301 17:52921581-52921603 CACAGAAGCTTTTAGGTGAAAGG - Intergenic
1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG + Intronic
1151257158 17:72886784-72886806 CCCTGGAGCTTGTAGGTGCTTGG - Intronic
1151301825 17:73232418-73232440 ACTAGGAGCTTCTGGGAGAAAGG + Intronic
1151400612 17:73853530-73853552 ACCTGTAGCTTGTAGGTAATGGG - Intergenic
1152001011 17:77645227-77645249 ACCGGGAGCGTGGAGGTGAGAGG - Intergenic
1152108749 17:78345398-78345420 ACCAGGAGCTGGCAGGGGCAAGG + Intergenic
1152469381 17:80482372-80482394 AACAGGAGTTTGCAGGGGAAAGG + Intergenic
1153499664 18:5735446-5735468 ACCAGGAAAATATAGGTGAAGGG - Intergenic
1153762983 18:8349678-8349700 ACCAGGAGTCTGAAGATGAATGG - Intronic
1156858402 18:41809725-41809747 AGCAGGAGTGTGAAGGTGAATGG - Intergenic
1157514730 18:48302792-48302814 ACCAGGAGCTGGCAGGTGTCTGG + Intronic
1158694765 18:59694250-59694272 ACCAGGTGGCTGTTGGTGAATGG - Intronic
1158844532 18:61427925-61427947 AGCAAATGCTTGTAGGTGAATGG - Intronic
1159624421 18:70675456-70675478 ACCAAGAGCTTGGAGGTTCAAGG + Intergenic
1162069787 19:8146904-8146926 ACAAGGAGGTTGTAGGGCAAAGG + Intronic
1162376961 19:10310508-10310530 ACCAGGAACTTCTACGTGGATGG - Exonic
1163228335 19:15980347-15980369 AGGAGGAACCTGTAGGTGAAAGG + Intergenic
1164497480 19:28780595-28780617 ACCAGGAGCTTGCTTTTGAAAGG + Intergenic
1165212968 19:34250197-34250219 TCCAGTAGCTTTTAGGTGAAAGG - Intergenic
1165241983 19:34476294-34476316 ACCAGGAGCTCGAAGCTGCAGGG + Intergenic
1165906824 19:39199355-39199377 ACCAGGAGGGTCTTGGTGAAGGG - Intronic
1165919416 19:39285143-39285165 ACCAGGGGCTTGGAGGAGAGGGG + Intergenic
1167507835 19:49880531-49880553 CCCAGGAGCATGGAAGTGAATGG + Intronic
925375245 2:3379584-3379606 ACCAGGAGCCGGTAGTTGAGGGG - Intergenic
926427069 2:12747763-12747785 ACCAGAAGCTTGAAGATGCAAGG + Intergenic
927709334 2:25315134-25315156 ACCAGGAACTGGAAGGGGAAGGG - Intronic
928195536 2:29214109-29214131 ACGAGGAGCTTGTCAGTGAGAGG + Intronic
928197445 2:29225756-29225778 AGCAGTAGCTTTTGGGTGAAGGG + Intronic
928372752 2:30752933-30752955 ACCATGAGCCTGAAGCTGAAAGG - Intronic
929873389 2:45776434-45776456 ACCAGGAACTTGCAGATTAAAGG + Intronic
930592199 2:53341459-53341481 ATCAGGTGATTGTAGGTGCATGG + Intergenic
932338978 2:70947894-70947916 TCCAGGAGCTTGTATCTTAAGGG - Intronic
935548822 2:104430316-104430338 GCCTGGAGGTTGGAGGTGAAAGG - Intergenic
935730248 2:106059278-106059300 AGCAGGAGCTTGTAGCTCCATGG - Intergenic
940350337 2:152678406-152678428 AGCAGCAGATTGTAGGAGAATGG - Intronic
944817966 2:203398713-203398735 ACCAGGAGCTGGGAGTGGAAGGG - Intronic
947126536 2:226874504-226874526 ACCAGGAGCTGGAAGGAGTAAGG - Intronic
947442033 2:230131929-230131951 ACCAGGAACACGGAGGTGAAGGG - Intergenic
947736487 2:232457968-232457990 ACAAGGAGCTTGGTGGTGATTGG - Intronic
1169344082 20:4816441-4816463 ACCAGGAGCTGGAAGGAGAAAGG + Intronic
1169532256 20:6498322-6498344 ACCACGAATTTTTAGGTGAAAGG - Intergenic
1169619924 20:7494204-7494226 ATCAGTAGCTTGTAGGTGTCTGG - Intergenic
1169705893 20:8504313-8504335 ACCAGGAACTTATAGCTCAAGGG - Intronic
1172580196 20:36041398-36041420 CCCAGGAGCCTGAAGGTGAGGGG - Intergenic
1173278470 20:41605197-41605219 AACAGGTGGTTCTAGGTGAAGGG + Intronic
1174532446 20:51224821-51224843 ACCAGGAGCTGGAAGGGGCAAGG + Intergenic
1175665255 20:60853101-60853123 AACAGAATATTGTAGGTGAAGGG - Intergenic
1176086016 20:63295897-63295919 CCCAGGAGCTTGCAGGTGCCGGG - Intronic
1177417090 21:20807940-20807962 ACCAGGGACTTCTAGGGGAATGG + Intergenic
950306281 3:11917305-11917327 CCCAGGAGCGGGTAGGTGGAGGG + Intergenic
953419006 3:42740238-42740260 ACCAGGAGCTAGAATGAGAAAGG + Intronic
954807078 3:53226830-53226852 TCCAGGGGCTTGATGGTGAAGGG + Exonic
956361917 3:68457788-68457810 ACCAGGAGCTTGGAGAAGGAGGG - Intronic
961349397 3:126289969-126289991 AAAAGGAGCATGTAGGGGAATGG + Intergenic
961378877 3:126484314-126484336 GGCAGCAGCTCGTAGGTGAATGG - Intronic
962389157 3:134957293-134957315 ACCAGGACCATGTATGTGACTGG + Intronic
963641334 3:147864331-147864353 ACCAGGAACTGGTGGGAGAATGG - Intergenic
965442715 3:168735637-168735659 ACCAGAAGCTGGGAGGGGAAAGG + Intergenic
967388011 3:188929286-188929308 TCCAGGAGCGGGCAGGTGAAAGG - Intergenic
968506973 4:975282-975304 ACCAGCAGCTTCTCGCTGAAGGG + Intronic
971372842 4:26032152-26032174 TCCTGGAACTTGTAGGTGGACGG + Intergenic
978114023 4:104997542-104997564 ACCAGATGGTTGTAGGTGCATGG + Intergenic
980897889 4:138877135-138877157 ACCAGGAGCTAGAAGGGGCAAGG + Intergenic
986854385 5:11851990-11852012 AACAGGAGATAGAAGGTGAAGGG - Intronic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
996036684 5:118766269-118766291 ACCAGGTGGTTGTAGGTGTGTGG - Intergenic
996329883 5:122316747-122316769 TGCATGAGCTTTTAGGTGAAAGG - Intronic
998793449 5:145791557-145791579 GCCAGGGGCTAGGAGGTGAATGG + Intronic
1001565353 5:172696330-172696352 CCCAGGAGGTTGTAGGAGGATGG - Intergenic
1004074423 6:12332040-12332062 TCAAGGAGCTTGTTGCTGAATGG - Intergenic
1006132003 6:31875143-31875165 GCCAGGAGCTGGGAGGTGACTGG - Intronic
1006392187 6:33764991-33765013 ACCAGGATCTTGAAGGTGACTGG - Intergenic
1008022462 6:46596026-46596048 ACCAGGAGCTTTTAAACGAATGG + Exonic
1008203165 6:48617833-48617855 ACCAGGTGGTTGTAGGTGTGTGG + Intergenic
1011441406 6:87391138-87391160 TCCTGGAGCTAGTAGCTGAAGGG + Intronic
1011970475 6:93216194-93216216 ACCAGGTGGTTGTAGGTGTGTGG + Intergenic
1012733325 6:102909088-102909110 ACAAGAGGCTGGTAGGTGAAAGG - Intergenic
1013003599 6:106049316-106049338 ACCTGAGGCTTGTTGGTGAAAGG - Intergenic
1013790011 6:113825846-113825868 ACCAGGATGTTGTAGGGGATTGG - Intergenic
1014193979 6:118531199-118531221 ATCAGGTGGTTGTGGGTGAATGG - Intronic
1015248542 6:131102843-131102865 ACCAGGAGCTGGTGGGTAATAGG - Intergenic
1015509802 6:134027101-134027123 TCAGGGAGATTGTAGGTGAATGG - Intronic
1016120906 6:140340133-140340155 ACTAGGAGCTTTTATGTGCAAGG - Intergenic
1016869388 6:148801646-148801668 ACCAGGAGCTTGGAAGTTGATGG - Intronic
1019886736 7:3912000-3912022 AGCAAGAGCTTGTAGGTGCGGGG + Intronic
1019960230 7:4452943-4452965 AGAAGGAGGTTGTAGGTGAGAGG - Intergenic
1022553612 7:31268859-31268881 ACCAGGGGCTGGGAGGTGGAAGG - Intergenic
1023129755 7:36990979-36991001 ACCAGGAGCTGGAAAATGAAAGG - Intronic
1023835826 7:44066582-44066604 AACAGGAGCGGGTAGGTGAGAGG + Intronic
1028155282 7:87422524-87422546 ACCAGGAGCTGGGAGGAGGAGGG - Intronic
1030535272 7:110758486-110758508 GCCATGTCCTTGTAGGTGAAAGG + Intronic
1033621064 7:143062480-143062502 CCCAGCAGCCTGTAGGTGAGAGG - Intergenic
1035044729 7:155956172-155956194 TCCATGAGCTTGTAGGTGAATGG + Intergenic
1037081873 8:14797354-14797376 ACGAGGAACTTGTTGGTAAATGG + Intronic
1037293465 8:17375460-17375482 AACATAAGCTAGTAGGTGAAGGG - Intronic
1038625804 8:29192314-29192336 ACCAGGTGCCTGGAGGTGATTGG - Intronic
1038830857 8:31058669-31058691 ACCAGGACCTAGTTGTTGAAAGG + Intronic
1042178003 8:66056476-66056498 GCCAGGTGCCTTTAGGTGAAGGG - Intronic
1044653383 8:94522624-94522646 AACAGGACCTAGTAGGCGAAGGG - Intronic
1046768351 8:118094356-118094378 ACCAGGAGCTTCTATATGACTGG + Intronic
1047816918 8:128474343-128474365 AGCAGGAGCCTGTGGGTGGAAGG - Intergenic
1048018052 8:130514865-130514887 ACCAGAAGCTTGAAGGGGCAAGG - Intergenic
1049749212 8:144275568-144275590 ATAAGGAGCTTGCAGGCGAAGGG - Intronic
1051837683 9:21359521-21359543 TCCAGGAGTTTGTAGTTGATGGG - Intergenic
1055145907 9:72934435-72934457 ACCTTGAGATTGTAGATGAAAGG - Intronic
1057410535 9:94813433-94813455 ACCTGGAGCTTGTTTGTGAGAGG - Intronic
1058607081 9:106734463-106734485 AGCAGGAGCTTGGAGGAAAAAGG + Intergenic
1059401485 9:114073061-114073083 ACCAGGTGCTTGGAGTGGAAGGG + Intronic
1061133860 9:128722514-128722536 ACCAGGAGCAGGAAGGTGAGGGG + Exonic
1061250993 9:129426288-129426310 AACAGGAGCTGGTGGCTGAAGGG + Intergenic
1061766939 9:132887495-132887517 TCCAGGAGGTTGTTGGTGACTGG - Exonic
1062682327 9:137788522-137788544 GCAGGGATCTTGTAGGTGAAGGG + Intronic
1185626535 X:1486803-1486825 GCCAGGAGGGTGTAGGGGAAGGG - Intronic
1186479180 X:9883154-9883176 TCCAGGAGCTTGCAGCTGAGTGG + Intronic
1188008623 X:25036050-25036072 ACCATGAGCTTGTCTGTCAAAGG - Intergenic
1188372438 X:29385508-29385530 ACCAGGAGCTGGTGGGAGGAAGG - Intronic
1188945768 X:36299664-36299686 ACCAGGCGCTGGGAGGTGGAGGG - Intronic
1188979595 X:36715035-36715057 ACCAGGAGGTTCAAGGTGAGAGG + Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1192839634 X:74840779-74840801 ATCAGATGGTTGTAGGTGAAAGG + Intronic
1193006392 X:76623572-76623594 ACCATGAGCTTGGGGGAGAAGGG + Intergenic
1194620630 X:96166526-96166548 ACCAGGAGTTTCTAGGTGTCAGG - Intergenic
1197012856 X:121588283-121588305 ACAAGGAGCTTCTTGGTGAGAGG + Intergenic
1197714475 X:129696559-129696581 ACCAGGAGCTGGAAGGGGCAAGG - Intergenic
1198738636 X:139816288-139816310 AACAGGAAATTGGAGGTGAAAGG - Intronic
1199098960 X:143775588-143775610 ATCAGGTGATTGTAGGTGCATGG + Intergenic
1200408302 Y:2837343-2837365 ACCTGGAGTTTGCAGTTGAATGG - Intergenic