ID: 1150808943

View in Genome Browser
Species Human (GRCh38)
Location 17:68341387-68341409
Sequence AGGGAGAAACAGTATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150808943_1150808953 13 Left 1150808943 17:68341387-68341409 CCCTCCACATACTGTTTCTCCCT 0: 1
1: 0
2: 4
3: 37
4: 379
Right 1150808953 17:68341423-68341445 ACCATTCTTTTATTAGCTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150808943 Original CRISPR AGGGAGAAACAGTATGTGGA GGG (reversed) Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
900899201 1:5505374-5505396 AGGGAGGAACAGAATGTTGTTGG + Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
903167411 1:21530614-21530636 AGGGAGAAACAGTGAGGAGAAGG + Intronic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904269894 1:29343072-29343094 CAGTACAAACAGTATGTGGATGG - Intergenic
904643444 1:31947697-31947719 AGGGAAAACCATTATGGGGAAGG + Intergenic
905118079 1:35659872-35659894 GGGGAGAAAAACTCTGTGGAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
906668103 1:47635858-47635880 AGGAAGGAACAGGAGGTGGAGGG - Intergenic
907009203 1:50947195-50947217 AGGGAAAAAGAGGATGGGGAGGG + Intronic
908287157 1:62619437-62619459 AGGGAAAAACAGTATCTATAAGG - Intronic
909814382 1:79973860-79973882 AGGGAAAAAAAGTCTGTTGATGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
911842265 1:102698129-102698151 AGGGAGAAACAGTGTTGGAAAGG - Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912203830 1:107488696-107488718 ATAGAGATACAGTATGTGAAAGG + Intergenic
912617279 1:111115846-111115868 AGGGAAAAACAGTATATAGAGGG - Intergenic
912821336 1:112870266-112870288 ATGGACAAACAGCATGTGCAGGG - Intergenic
915060547 1:153179654-153179676 AGGAAGAAGTAGTATGTGGGAGG - Intergenic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916874157 1:168950936-168950958 AGGAAGAAATATTATGAGGATGG + Intergenic
917802530 1:178583323-178583345 AGGGAGAAACAGTATATATAGGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918109470 1:181442744-181442766 AGAAAGAGACAGGATGTGGAAGG - Intronic
918187281 1:182139381-182139403 AGGCAGGAACAGTACGTGCAGGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918948915 1:191109259-191109281 AGAGAGATAGAGTATGTGGAGGG + Intergenic
919109390 1:193198705-193198727 AGAGAGAAAAAGTTTGTGAAGGG + Intronic
919652477 1:200164072-200164094 AGAGAGAGAGAGTATGTGTAGGG - Intronic
919698978 1:200611718-200611740 AGAGAATAATAGTATGTGGATGG - Intronic
921364745 1:214362946-214362968 AGGTAGAATCAGTGTGTGCATGG - Intronic
922092609 1:222411125-222411147 AAGGGTAAACAGTATATGGATGG + Intergenic
922195201 1:223353678-223353700 AGGGAGAATCTGTATCCGGAGGG + Intronic
923649105 1:235856090-235856112 AGGGAAAAAAATTATGTGGGTGG - Intronic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG + Intergenic
1063520068 10:6733487-6733509 AGGGGGAAATAGTATGTACATGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066957714 10:42188711-42188733 TTGGAGAAAGAGTATGTAGAGGG + Intergenic
1068351096 10:55846084-55846106 AGGGAGAAAGAGAATTTGAAGGG + Intergenic
1069812884 10:71175510-71175532 AGCAAGAAACAGTATGTCAATGG + Intergenic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071818573 10:89256684-89256706 AGTGAGACACTGTATGTAGAGGG + Intronic
1072326293 10:94301924-94301946 AAGGATAAACATTATGTGAATGG + Intronic
1073003593 10:100304224-100304246 AGGGAGAAAGAGTGTTTGTATGG - Intronic
1073899097 10:108198463-108198485 AAGGAGAGACAGTATTTGAATGG - Intergenic
1074296642 10:112195364-112195386 AGAGCGAAAGAGTACGTGGACGG - Intronic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075923152 10:126229700-126229722 AAGGAGAAAGAGTGAGTGGAAGG - Intronic
1076275589 10:129195922-129195944 AGGGACACACAGTATGGGCAAGG - Intergenic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1078409808 11:11105134-11105156 AGGGAGGAACAGTGGGTGAAGGG + Intergenic
1079469132 11:20761708-20761730 TGGGAGAAAATGTATTTGGAAGG + Intronic
1079614853 11:22479592-22479614 CTGGAGAAACATTATGTGGCAGG + Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1080389714 11:31833829-31833851 AAGGAGAGACAGTATGATGAAGG + Intronic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1087015096 11:93546932-93546954 TGGAAGGAACAGCATGTGGAAGG - Intergenic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087229031 11:95638830-95638852 AGGAAGAAACAATATTTGAAGGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089710415 11:120310575-120310597 AGGGAGAAATGGTATCTGGAGGG + Intronic
1090512926 11:127394681-127394703 AGAGAGAAAGAGTTTGTGCAGGG - Intergenic
1090532577 11:127606380-127606402 TGGGAGAAATAGTATTCGGATGG - Intergenic
1090785334 11:130043222-130043244 AGAGAGATTGAGTATGTGGAAGG + Intergenic
1090937401 11:131355951-131355973 AGGAAGAAACAGAATATGAAAGG - Intergenic
1091317894 11:134628289-134628311 ATGCAGAAACAGTATGGGGCAGG - Intergenic
1091673738 12:2471999-2472021 AGGAAGAAACATTATGTGCAGGG - Intronic
1091972209 12:4797009-4797031 GGGGAGGATCAGTTTGTGGAGGG - Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092648768 12:10610127-10610149 AGGGAAAAAATGTATGTGAAAGG - Intronic
1093887435 12:24478693-24478715 AGAGTGCAACAGGATGTGGAAGG - Intergenic
1094583230 12:31753825-31753847 AGAGAGAAAAAGGAGGTGGAAGG + Intergenic
1098135519 12:67397672-67397694 AGGCAGAAAAAGTGGGTGGAGGG + Intergenic
1098308869 12:69128184-69128206 AGGAAGAAACCCTATGTGGTAGG + Intergenic
1098324798 12:69290246-69290268 AGGGAGAAACATTAAGTGTCTGG + Intergenic
1099188257 12:79539221-79539243 AGGGAGATGCATTTTGTGGAGGG + Intergenic
1099360988 12:81701426-81701448 AGGGATCAAAATTATGTGGATGG - Intronic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1100664282 12:96733992-96734014 AGGGAGGAAGAGTGTGGGGAGGG + Intronic
1100908588 12:99332056-99332078 AGGGAGGAACAAACTGTGGAAGG - Intronic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1104497188 12:129251898-129251920 AGGCAGAAACACAAGGTGGAAGG + Intronic
1104661292 12:130613015-130613037 AGGGAGAAACAGCTGGTGAATGG - Intronic
1105003763 12:132708372-132708394 GGGGAGAAACGAAATGTGGAAGG + Intergenic
1107088278 13:36448770-36448792 AGAGAGAAAGAGCATGTGAAGGG - Intergenic
1108044036 13:46366133-46366155 AGGGAGAAAATGAATGTGGGTGG - Intronic
1108837632 13:54571890-54571912 AGGGAGAAAAATTATGTGATAGG + Intergenic
1109668667 13:65574011-65574033 AAGGAAAAAGAGTATATGGAAGG + Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1115758605 14:36555319-36555341 AAGGAGAAAAACTATGTGGGAGG + Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1117982512 14:61356129-61356151 AGGGTGAAAGAGGAAGTGGAGGG + Intronic
1118006343 14:61567546-61567568 ATGGAGAGACATTATGTTGAAGG - Intronic
1118035081 14:61857838-61857860 GGGAAGAAAGAGTATATGGAAGG + Intergenic
1118359669 14:65045364-65045386 AGGAAAAAAAAGTATGGGGAGGG - Intronic
1118508521 14:66443851-66443873 AGAGAGAAAGAGTTTGGGGAAGG + Intergenic
1118709363 14:68507056-68507078 AGGGAGAGTGTGTATGTGGAGGG + Intronic
1118878204 14:69802788-69802810 AGGGAGAAAGAGAATGCAGAGGG + Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1121447450 14:93987972-93987994 AGGGAGAAACAGTAGGGAGGTGG + Intergenic
1121802228 14:96784382-96784404 AGGGGGAAACAATAATTGGAAGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1123133828 14:106009876-106009898 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1202935391 14_KI270725v1_random:83065-83087 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1123583852 15:21740297-21740319 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1123620502 15:22182900-22182922 AGGGAGAAGGAGTTTATGGAGGG - Intergenic
1126406211 15:48325311-48325333 AGGGGAAAAGAGTAGGTGGAGGG - Intergenic
1127250526 15:57232184-57232206 AGGGAGGAAAAATATCTGGAGGG + Intronic
1127277803 15:57462505-57462527 AGAGAAAAACAGTATTTTGAAGG + Intronic
1127517878 15:59713786-59713808 ACAGAGAAACTGTATGTTGAAGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131456190 15:92584481-92584503 AAGGAGAGAGAGTAAGTGGATGG - Intergenic
1132518976 16:378765-378787 AGGGAGATACTGCATGTGGGAGG + Intronic
1132996963 16:2828521-2828543 AGGCAGAAACAGGAGGTGGTTGG + Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134091848 16:11395765-11395787 AGGGAGACAGAGGAGGTGGATGG + Intronic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1135770301 16:25213156-25213178 TGGGAAAAAGAGAATGTGGAGGG - Intergenic
1135780215 16:25293475-25293497 AGGAGGGAACAGTATGTGCAAGG + Intergenic
1135835821 16:25824266-25824288 GGCCATAAACAGTATGTGGAAGG - Intronic
1136654711 16:31702958-31702980 AGGGAGGCACAGGATGTGAAAGG + Intergenic
1137492630 16:48945498-48945520 AGTGAGGAACATTCTGTGGAAGG - Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1138467752 16:57204941-57204963 AGAAAGAAACAAAATGTGGATGG + Exonic
1138535672 16:57659050-57659072 GGGAAGACACAGAATGTGGATGG + Intronic
1138827386 16:60336916-60336938 AAGGAGAAAGAGTTTGTGTAGGG - Intergenic
1139669196 16:68480252-68480274 AGGCAGAAAGGGTATGTGGCTGG + Intergenic
1140960010 16:79902695-79902717 AGGAAGAAGCACTATTTGGATGG + Intergenic
1141332089 16:83120140-83120162 CGGGAAAAACAGTACCTGGAAGG - Intronic
1141337992 16:83175490-83175512 CAGGAGAAACTGTATGGGGATGG + Intronic
1141349178 16:83276916-83276938 AGGCAGAGAGAGTATGTGCAGGG + Intronic
1144579407 17:16449990-16450012 AGGAGGAAACAGTCTGTGGCAGG + Intronic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1147496297 17:40919328-40919350 ATGTAGCAACAGTATGTGGAGGG - Intergenic
1148784775 17:50140713-50140735 GGAGAGAAACAGGATGTGGGTGG - Intronic
1150709014 17:67514109-67514131 AGGGAGAGACTGTGTGGGGAGGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1157373487 18:47140315-47140337 GGAGAGATACAGTATGTTGATGG - Intronic
1158220932 18:55149972-55149994 AGGAAGAAAGGTTATGTGGATGG + Intergenic
1158945540 18:62444154-62444176 AGGGAGAGACAATCTCTGGATGG + Intergenic
1159500632 18:69264655-69264677 AGGGTCAAGCAGTATGTTGATGG - Intergenic
1160555739 18:79723801-79723823 AGGGAGGGACAGCAGGTGGAGGG - Intronic
1160926906 19:1550797-1550819 AGGGACACACGGTGTGTGGATGG + Intergenic
1162926863 19:13935162-13935184 AGGTGGAGACAGTATGTGCAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164803469 19:31097380-31097402 ACGGAGGAACAGTGTGTGGGAGG + Intergenic
1164835481 19:31352600-31352622 AGGGAGAAATAGTGTCTGGATGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166325785 19:42050291-42050313 AGGGGCAAACAGTGTGTGGATGG + Intronic
925609004 2:5688153-5688175 GGGGATAGACACTATGTGGAAGG + Intergenic
925881709 2:8358120-8358142 AGGGAGAGACAGGAGATGGAGGG + Intergenic
925888713 2:8415599-8415621 GTGTATAAACAGTATGTGGAGGG + Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926983848 2:18599588-18599610 AGAGAGAAACAGGATGTGACAGG - Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
928365884 2:30702205-30702227 GGGCAGAAACAGTATTTGTAAGG - Intergenic
928366572 2:30707578-30707600 GGGGAGGCACAGGATGTGGAGGG - Intergenic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929352373 2:40973120-40973142 AGGGAGAAAAAATATATAGAAGG + Intergenic
931088974 2:58865330-58865352 AGGGAGAAATATTATGGGTAGGG - Intergenic
931195351 2:60047508-60047530 AGGGAGATACAGAGTGTGGCTGG + Intergenic
932294717 2:70614860-70614882 AGTGAGAAACAGTCAGTGGTAGG - Intronic
932332896 2:70908393-70908415 AGGCATAAACATTATCTGGAAGG - Intronic
933303153 2:80565595-80565617 TGGTAGAAACAGTGTGTGCATGG + Intronic
933650145 2:84843872-84843894 AGGGAGGTAAACTATGTGGAAGG - Intronic
934099681 2:88641082-88641104 AGGAAGCTACAGTATGGGGAGGG - Intergenic
934305831 2:91821225-91821247 TTGGAGAAAGAGTATGTAGATGG + Intergenic
934327425 2:92031517-92031539 TTGGAGAAAGAGTATGTAGATGG - Intergenic
934465809 2:94262097-94262119 TTGGAGAAAGAGTATGTAGATGG - Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935672007 2:105563860-105563882 AGAGAGATATAGAATGTGGAGGG - Intergenic
935710501 2:105893821-105893843 AGGAAAAAGCACTATGTGGATGG - Exonic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936341922 2:111641295-111641317 AGGAAAAAACATCATGTGGAAGG + Intergenic
937031673 2:118745934-118745956 AGGGCAAAAGAGTATGTGCAAGG + Intergenic
937383079 2:121399394-121399416 AGGGAGAGACATTTTGTGGGTGG - Intronic
937564564 2:123268397-123268419 AGGTAGAAATAGCATCTGGAAGG + Intergenic
938733839 2:134168184-134168206 AGGGAGACACAGTCTGTGTGTGG - Intronic
940684732 2:156832842-156832864 AAGGAAAATCAGTATATGGAAGG + Intergenic
941195293 2:162443367-162443389 AGGGAGAAAAAGTGTGTTGTGGG - Intronic
941358571 2:164523053-164523075 AGAGAGAGACAGTAAGTGGGGGG + Intronic
941391029 2:164914879-164914901 AGGAAGTGACAGTGTGTGGAAGG + Intronic
942772799 2:179542861-179542883 AGGAAGTAAAAGTATGTGCAGGG + Intronic
944878661 2:203988694-203988716 AGTAAGAAAAAGTATGTGCAAGG - Intergenic
945479323 2:210325826-210325848 AGGGAGAAACAACTTGTGGTTGG + Intergenic
945508811 2:210674683-210674705 AGGGATCAAGATTATGTGGATGG + Intronic
945977655 2:216283278-216283300 AGGGAGAATAAGTAAGTGAAAGG - Intronic
946101394 2:217327733-217327755 AAGGAAAGACAGTATGTTGAGGG + Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947191067 2:227505390-227505412 AGGCAGAAAAAATATTTGGAAGG - Intronic
947951429 2:234150861-234150883 AGGGAAAAACAGTGCCTGGAAGG + Intergenic
1169040571 20:2491679-2491701 AGCCATAAACAGTATGTGAACGG - Intronic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169565214 20:6846658-6846680 AGGGAGAAAAAGCATATGGTTGG + Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1171956145 20:31465378-31465400 TGGGAGAAATGGTCTGTGGAGGG - Intergenic
1172004145 20:31806171-31806193 AGGAAGAAACAGTCTCTGCAAGG - Intergenic
1173275999 20:41583061-41583083 ACGCAGAAACAGTATTTGGCAGG + Intronic
1173338538 20:42133761-42133783 TAGGGGAAACAGTATGTGGGTGG + Intronic
1174397470 20:50256781-50256803 AGGGAGGGACAGGATGTGTAAGG + Intergenic
1174465748 20:50715996-50716018 AGGCAGAAACTTTAGGTGGAAGG - Intergenic
1174551336 20:51364122-51364144 AGGAAGAAACAGTAAAAGGAAGG + Intergenic
1174827745 20:53783855-53783877 AGAAAGAAAAAGAATGTGGAGGG + Intergenic
1175670748 20:60900866-60900888 GGGGAGCAACAGCTTGTGGAAGG - Intergenic
1176596811 21:8705301-8705323 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1180279731 22:10682743-10682765 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1180580717 22:16833786-16833808 AGGGAGATACACTATGTTCATGG - Intergenic
1180586950 22:16901269-16901291 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1183401514 22:37607886-37607908 AGGGAGAAAAAGTAGGATGAAGG - Intergenic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184844982 22:47077163-47077185 GGGGAGAAAGAGTATTTGGTCGG + Intronic
949185144 3:1181681-1181703 AGGGATAAACCCTATGTGCAGGG - Intronic
949194886 3:1293237-1293259 AAGGAGAAAGAAAATGTGGAAGG - Intronic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
951933170 3:27992858-27992880 AGGGAGTGACAGTTTGTGTATGG - Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952924187 3:38309226-38309248 TGGGAGAAAGTGCATGTGGATGG + Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955639353 3:61065877-61065899 ATGGAGATACAGTAAGTTGAAGG - Intronic
955866774 3:63392539-63392561 AGGGAGATAATGTATGGGGAAGG + Intronic
956045096 3:65187646-65187668 AGGGAGAAACACAATGTCCATGG - Intergenic
957127206 3:76177219-76177241 AAGGAGAAACATTTTTTGGAAGG + Intronic
957217847 3:77344859-77344881 AAGAAGAAACAGTATGTTCATGG - Intronic
957387152 3:79510678-79510700 TGGGAGAAAAAATATGTGTAAGG + Intronic
958024920 3:88039348-88039370 GGGTAGAAACAGTGTGTGCAGGG + Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960645328 3:119874287-119874309 AGAGAAAAACAGTATATGTAGGG - Intronic
961465699 3:127079826-127079848 ACGGAGAAACAGCAAGTGCAAGG - Intergenic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
963237788 3:142972569-142972591 AGAGAGAAACAGCAAGTGCAAGG - Intronic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964948837 3:162261925-162261947 ACAGAGAAACCGTCTGTGGAAGG + Intergenic
965674080 3:171176533-171176555 AGGGAGAAAAGGTAGGTGGAAGG + Intronic
967376606 3:188810617-188810639 AGGAAAAAACAGTATGTATAGGG + Intronic
969666427 4:8560078-8560100 AGGGTGAAAGGGTTTGTGGAGGG - Intronic
971436378 4:26629065-26629087 AGAGAGAGAAAGTATGTGCATGG - Intronic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972978090 4:44662171-44662193 AGGAAGAAACAGTATATATAGGG - Intronic
973209949 4:47604672-47604694 AGGGAGAAACAGTAAGATGTGGG - Intronic
973292044 4:48480963-48480985 AGGGGGAAACAATATGTAAAAGG - Intergenic
974639279 4:64608237-64608259 ATGGAGAAATAGTAGGTGAAGGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
975185523 4:71397792-71397814 AAGGAGAAGCAGTGTGTGAAGGG + Intronic
975450978 4:74526365-74526387 AGGGAGAGATAGTGTGTGTATGG + Intergenic
975543702 4:75539810-75539832 AAAGAAAAACAGTATGTGGATGG - Intronic
975600326 4:76093119-76093141 AGTCAGAAACAGCATGTTGATGG + Intronic
976651891 4:87444488-87444510 AGGTTCTAACAGTATGTGGATGG - Intronic
976914164 4:90349554-90349576 AGGAAGAAACAGTATATACAAGG - Intronic
977423622 4:96836686-96836708 AGTGAGAAAATGCATGTGGAAGG + Intergenic
978607070 4:110492315-110492337 AGCAAGATACAGTATCTGGAAGG - Intronic
978833017 4:113112422-113112444 AGGGGGAGACAGAATGTGTATGG + Intronic
979037746 4:115747152-115747174 AGGGAGAAAGATTATTTGAAAGG + Intergenic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
980727755 4:136787166-136787188 AGGGAGGAACAGTTTTTGGAGGG + Intergenic
981743400 4:148027998-148028020 AAGGAAAAACCGTATGTGGCAGG - Intronic
982256488 4:153456363-153456385 AGGGGGAAAAAGTATGCAGAGGG + Intergenic
984498085 4:180523854-180523876 AGGGAGAGAGAGTAAGTGAAAGG + Intergenic
985236861 4:187884635-187884657 AAGGAAAAAAAGTATGTGGATGG - Intergenic
985798035 5:1979132-1979154 AGGAAGAGACAGCATGTGCAGGG + Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
986418488 5:7552343-7552365 AGTGAGAAGCAGTATTTTGATGG + Intronic
986519813 5:8602702-8602724 AGGGACACACAGAATGTGCAAGG + Intergenic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
989677829 5:43992959-43992981 AGGGAGAAACACTATGAGTTGGG + Intergenic
990317835 5:54600841-54600863 AGGGAGAGAGAGTATTAGGAAGG + Intergenic
990701649 5:58481147-58481169 AGGGAGTGACAGTGTGTGTAAGG + Intergenic
991459173 5:66838737-66838759 AGGAAGCAACAGTGTGTGCAAGG + Intronic
992132297 5:73705406-73705428 AGAGAAAGACAGTAGGTGGAAGG - Intronic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992389709 5:76319060-76319082 AGGGAGAATCACTTTGTGAATGG + Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993390837 5:87318547-87318569 CAGGAGAAACAGCATGTGAAGGG + Intronic
993662938 5:90661718-90661740 AGTGAGAAACTGTTTGGGGATGG + Intronic
993888074 5:93440137-93440159 AGGGAGAGAGAGAATGTGGGTGG - Intergenic
994056169 5:95418629-95418651 AGGGAGAAACAATATATATAGGG + Intronic
997113205 5:131097859-131097881 AGGGAGAAAGATGATGTGGTAGG - Intergenic
997191051 5:131936004-131936026 AGACAGATACAATATGTGGATGG - Intronic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
1000355030 5:160386074-160386096 AGGGACCAACAGTATGAGCATGG - Intergenic
1000671238 5:164065808-164065830 AGAGAGAATCATTATGTGAAGGG - Intergenic
1001147727 5:169199436-169199458 AGGGAGGAACACTGTGCGGAAGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001866759 5:175112994-175113016 AGGAAGAAACAGTGTTGGGAAGG + Intergenic
1002533263 5:179862163-179862185 AGGAAAAAACAGTATGTATAAGG + Exonic
1002614474 5:180442215-180442237 AGGAAGGGACAGGATGTGGAGGG + Intergenic
1004423436 6:15491492-15491514 AGAGAGAAACAGTTGGTGGCTGG - Intronic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004927471 6:20429476-20429498 AGGAAAAAACAGTATGTATAGGG + Intronic
1005478833 6:26235309-26235331 AGGGAGAAATAGTATTTTTAAGG - Intergenic
1006917105 6:37601808-37601830 AGGGAGCCCCAGTCTGTGGATGG - Intergenic
1007081347 6:39107231-39107253 AGGAAGAAAGAGGAAGTGGACGG - Intronic
1007124908 6:39417874-39417896 AGGGAGAAACAGTTTATAAAAGG + Intronic
1008926030 6:56893149-56893171 TGGGAGGAAGAGTATGAGGAGGG - Intronic
1011260424 6:85464765-85464787 AGGCAGCAACAATAGGTGGATGG + Intronic
1012369245 6:98482602-98482624 AGGCAGAAAGAGGATGTGAAGGG + Intergenic
1015766958 6:136728934-136728956 AGGGAGAAACCTAGTGTGGAGGG + Intronic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1015902416 6:138081812-138081834 AGGCAAAAACAGTACATGGAAGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017984004 6:159426608-159426630 ATGGAAAAACAGTATGTGCATGG + Intergenic
1019351812 7:557558-557580 AGGGAGAAACAGGATGGACATGG + Intronic
1020859675 7:13475543-13475565 AGGGAGAAATATTTTGTGAAAGG - Intergenic
1020915081 7:14183506-14183528 AAGGAGAAACTGTATGGGGAAGG + Intronic
1021315174 7:19140161-19140183 AGTGAGATAAAGTATGTGAATGG + Intergenic
1022274967 7:28846240-28846262 AGGGAGGAAGGGGATGTGGAGGG + Intergenic
1022321675 7:29293743-29293765 AGGGGGAAACAGTGTGGGAAAGG - Intronic
1022543291 7:31159984-31160006 ATAGAGAAACTCTATGTGGAAGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1023967264 7:44969506-44969528 AGGCACAAAAGGTATGTGGAGGG + Intronic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1024458058 7:49631327-49631349 AGGGAAAGACAGCATGTGAAAGG + Intergenic
1025898490 7:65725162-65725184 AGAGAGACACAGTCGGTGGATGG - Intergenic
1026258442 7:68733273-68733295 GAGGAGACACAGTATGTGAAAGG - Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027648120 7:80830734-80830756 AGGGAGACTCAGTAACTGGAAGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1029395562 7:100306101-100306123 AGGCACAAACTGAATGTGGAAGG - Intergenic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1030933534 7:115555782-115555804 AGGCAGAGACAGCATGTGAAAGG + Intergenic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1031898963 7:127389151-127389173 AGGGAGAGAGAGTAAGTGGAAGG + Intronic
1032581294 7:133105700-133105722 AGGGGCAAACAGTCTATGGAGGG - Intergenic
1032916415 7:136495166-136495188 AGGAAGAGACAGTATTTGAAAGG - Intergenic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1036467836 8:9018192-9018214 GGGAAGAAACAGTATGAGAAAGG - Intronic
1036569988 8:9971750-9971772 ATGGATAAACAGAATGTGGTAGG - Intergenic
1037166201 8:15832011-15832033 ATGAAAAAACAGTATGTTGAAGG + Intergenic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039122817 8:34167922-34167944 AGGGAGAAAGAGCAAGTGCAAGG - Intergenic
1039236610 8:35509185-35509207 ACGGAGAAATAGTATATGGTGGG + Intronic
1039806514 8:41004621-41004643 AGTGAGATACACTATGTGTATGG + Intergenic
1041170075 8:55132381-55132403 AGGGAAAAACAGTATATATACGG - Intronic
1042999940 8:74745689-74745711 AAGGAAAAGCACTATGTGGATGG + Intronic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043432478 8:80208321-80208343 AGGGAGAAACAATGTGCTGAAGG - Intronic
1043461621 8:80466207-80466229 ATGGAGAAAAAGTAAGTGGTGGG - Intergenic
1043850129 8:85206435-85206457 AGGGATCAACTGTGTGTGGAAGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045180111 8:99771720-99771742 GGAGAGAAACAATATCTGGAAGG - Intronic
1045670257 8:104543482-104543504 AGGGAGAGACAGCTTGTTGATGG - Intronic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046362842 8:113184908-113184930 AAGGAGAAAGAGTAACTGGAAGG - Intronic
1048524031 8:135184821-135184843 AGGGAGGAATAGAATGTGCAAGG - Intergenic
1051011007 9:12414427-12414449 AGGGAGAAAGAGTTGGGGGAGGG - Intergenic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1051560624 9:18436897-18436919 AGGCAGGAGCAGTAGGTGGAGGG + Intergenic
1052757854 9:32559157-32559179 GGGGAGGAACAGTTTGGGGATGG - Intronic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053695870 9:40638874-40638896 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1053942857 9:43269911-43269933 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1054307117 9:63438092-63438114 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1054405848 9:64762083-64762105 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1054439475 9:65247570-65247592 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1054490932 9:65774369-65774391 TTGGAGAAAGAGTATGTAGATGG + Intergenic
1056802760 9:89704763-89704785 TAGGAGAAACAGTGTCTGGAAGG + Intergenic
1057390867 9:94640469-94640491 AGGAAGACACGGAATGTGGAGGG + Intergenic
1059366289 9:113789045-113789067 AAGGAGAAAGCGTGTGTGGAAGG + Intergenic
1059571372 9:115440045-115440067 AGTGAGAAACAATATGTAGAAGG - Intergenic
1059665545 9:116443211-116443233 AGGAAGAACCAGTTTATGGAAGG + Intronic
1060310522 9:122456171-122456193 AGGGAGGAAGAGTCTGGGGATGG + Intergenic
1061575902 9:131505858-131505880 AGGGAGAGACAGAATCTGTATGG + Intronic
1062089723 9:134669141-134669163 AGGAAGGAAGAGTAGGTGGAAGG - Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1202778315 9_KI270717v1_random:12486-12508 TTGGAGAAAGAGTATGTAGATGG - Intergenic
1185946610 X:4384094-4384116 AGAGAGAGAGAGTATGTGCAGGG - Intergenic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187631269 X:21175318-21175340 AGGGAGAAAGAGTATGGAGGGGG + Intergenic
1188337019 X:28948792-28948814 AGGGAAAAACAGTATATATAGGG - Intronic
1189136649 X:38557431-38557453 AGGGGGTAACAGTAGGAGGAGGG + Intronic
1189649539 X:43174691-43174713 AGGAATAAACAGTACTTGGAGGG + Intergenic
1189898997 X:45686502-45686524 AGGGAGAGACAGCATGAAGAAGG - Intergenic
1190473046 X:50801571-50801593 AAGCAGATACAGTATGTGCAAGG + Intronic
1191780213 X:64856521-64856543 GGTGAGAAAGAGTAGGTGGATGG - Intergenic
1194638968 X:96379341-96379363 ACGGATAAATAGTATTTGGAAGG - Intergenic
1194650315 X:96506406-96506428 AGAGAAAAACAAAATGTGGAGGG + Intergenic
1195901234 X:109799862-109799884 AGGGAGAAACAATACCCGGATGG + Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196904916 X:120421527-120421549 AGGGAGAAACACTTTTTGGGTGG + Intergenic
1197196738 X:123709952-123709974 AAGGAGAAGCAGTGTGTGCAAGG + Intronic
1197243716 X:124146925-124146947 AGGTAGCCACAGGATGTGGATGG + Intronic
1197516677 X:127440679-127440701 AAGATGAAACAGTATGTAGAAGG - Intergenic
1198835401 X:140799435-140799457 AGGAAGAAAAACCATGTGGATGG - Intergenic
1199600947 X:149540683-149540705 AGGGAGGAAGAGTAAGTGGAAGG - Exonic
1199746993 X:150778201-150778223 AGGGAGTAGCTGTCTGTGGAAGG - Intronic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201438471 Y:13985084-13985106 AGGGAGGAACAGAAGGTGGGTGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201446102 Y:14057624-14057646 AGGGAGGAACAGAAGGTGGGTGG + Intergenic
1201670305 Y:16512768-16512790 AGGGAGAAAAATCATGTAGATGG - Intergenic
1201719259 Y:17078912-17078934 AGGGAGAAACAAGAAGTGTATGG + Intergenic