ID: 1150809833

View in Genome Browser
Species Human (GRCh38)
Location 17:68347633-68347655
Sequence CAGCTTTGGTAGCTTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150809833_1150809838 8 Left 1150809833 17:68347633-68347655 CCAAGATCAAGCTACCAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1150809838 17:68347664-68347686 AAAATCACTTTGCTGAAGGGCGG 0: 1
1: 0
2: 2
3: 31
4: 214
1150809833_1150809837 5 Left 1150809833 17:68347633-68347655 CCAAGATCAAGCTACCAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1150809837 17:68347661-68347683 CTGAAAATCACTTTGCTGAAGGG 0: 1
1: 0
2: 2
3: 35
4: 300
1150809833_1150809836 4 Left 1150809833 17:68347633-68347655 CCAAGATCAAGCTACCAAAGCTG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1150809836 17:68347660-68347682 TCTGAAAATCACTTTGCTGAAGG 0: 1
1: 0
2: 3
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150809833 Original CRISPR CAGCTTTGGTAGCTTGATCT TGG (reversed) Intronic
900525992 1:3128926-3128948 CAGCCTTGGTTTCTTCATCTGGG + Intronic
902420367 1:16274448-16274470 AAGTTTTCGTATCTTGATCTAGG + Intronic
905687801 1:39921397-39921419 CAACTTTGGTAGCTTGCAGTTGG + Intergenic
905818630 1:40971878-40971900 CAGCTTTGGTAGGCTGAGGTTGG + Intergenic
909846839 1:80404836-80404858 CAGCTTTTGTGGCCTGTTCTCGG - Intergenic
910016554 1:82532166-82532188 TAGCTTTGTTTGCTTGCTCTTGG + Intergenic
910902134 1:92132563-92132585 CAACTTTAGTAGCTTGTTCAAGG + Intronic
912568334 1:110604982-110605004 CAGCATTGGCAGCCTGACCTGGG + Intronic
912841203 1:113041179-113041201 CCTCTTTGGCAGCTTGATCTTGG - Intergenic
913068223 1:115276745-115276767 CAGCTTAGGTAACTTGCTCTGGG + Intergenic
913409746 1:118538014-118538036 AATCTTTGGTAGCTTGAAATTGG - Intergenic
915567395 1:156723236-156723258 CATCTTTGGAAGCTAGATTTGGG - Exonic
917665254 1:177220009-177220031 CAGCTTCAGTAGCTAGATCCAGG + Intronic
918890329 1:190258139-190258161 CAGCTGGGGAAGCTTGAACTGGG - Intronic
919240965 1:194915195-194915217 AAGCTTTTGTAGCCTAATCTTGG + Intergenic
921004147 1:211076071-211076093 CAGCTGGGGAAGCTTGAACTGGG + Intronic
921894150 1:220381491-220381513 CAACTTTGGTAGCTTGAAATTGG - Intergenic
922527043 1:226311987-226312009 CAACATTGGCACCTTGATCTTGG - Intergenic
923173706 1:231442795-231442817 CAGATGTGGTTCCTTGATCTTGG - Intergenic
923483244 1:234404394-234404416 CAACTTTGGTAGCTTGAGTTTGG + Intronic
1063108347 10:3013274-3013296 CAGATGTGATAGCTGGATCTGGG + Intergenic
1063515344 10:6689690-6689712 CAGCTCTGGCACCTTGATCTTGG - Intergenic
1065128759 10:22599774-22599796 CAGCTTTTGTGGTTTGAGCTAGG - Intronic
1065319797 10:24498705-24498727 CAGCTTTGGAAGGCTGATGTGGG + Intronic
1068359960 10:55965044-55965066 CATTGTTGGTACCTTGATCTTGG - Intergenic
1072244461 10:93530212-93530234 TTGCTTTGGTAACATGATCTGGG - Intergenic
1080348012 11:31347316-31347338 CTCCTTTCGTAGCTTGGTCTAGG + Intronic
1080666722 11:34342801-34342823 GAGGTTTGGTAGCTTGCTCACGG - Intronic
1081945159 11:46986181-46986203 CTGTCTTGGTAGCTTAATCTTGG - Intronic
1084791296 11:71476815-71476837 CCGATTTGGTGGCTTGATGTGGG - Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1093574993 12:20716629-20716651 CACCTTTGCTAGCTGCATCTGGG + Intronic
1094203506 12:27816875-27816897 AACCTTTGGTAGCTTGAAATTGG + Intergenic
1095426233 12:42077339-42077361 CAGCTTACCTAGATTGATCTAGG + Intergenic
1099660670 12:85556075-85556097 CAGATTTGGTAGTTTGACTTAGG + Intergenic
1101703123 12:107193963-107193985 CAGATGTGGCTGCTTGATCTTGG - Intergenic
1103341083 12:120221534-120221556 CAGTGTGGGTAGCTGGATCTTGG - Intronic
1110098595 13:71565623-71565645 CAGCTATGGAATCTTGATTTGGG - Intronic
1110493245 13:76134563-76134585 CAGCTTTGGTATATTGTTTTAGG + Intergenic
1115345658 14:32340753-32340775 AATCTTTGGTACCTTGACCTTGG - Intronic
1118293196 14:64545073-64545095 CTACTTTGGTGGCTTTATCTTGG - Exonic
1119886639 14:78149117-78149139 AAGCTGTGGTTGCTTGATATTGG + Intergenic
1120407966 14:84113395-84113417 CAGGTTTGATAGCTTGATGAGGG - Intergenic
1120619889 14:86750651-86750673 CCGCTTGGGAAGCTTGAACTGGG - Intergenic
1125141427 15:36412392-36412414 CAAATCTGGTACCTTGATCTTGG + Intergenic
1125646838 15:41279704-41279726 GAGCTTTGCTGGCTTGTTCTTGG - Exonic
1128660140 15:69494086-69494108 AACATTTGGTAGCTTGTTCTTGG + Intergenic
1128836625 15:70814045-70814067 CAGATGTGGCAACTTGATCTTGG - Intergenic
1129485654 15:75869535-75869557 CAATGTTGGTATCTTGATCTTGG - Intronic
1129888295 15:79054031-79054053 GACCTTTGGTAGCTTGAAATGGG - Intronic
1131262367 15:90893964-90893986 GAGCTTTGGCATCTTGCTCTGGG + Exonic
1132882220 16:2167503-2167525 CAGCTTTGGTGGCCTCCTCTGGG - Intronic
1133542475 16:6769705-6769727 AAGCTTCTGTGGCTTGATCTTGG + Intronic
1135143737 16:19943610-19943632 CAGCTTTAGAAGTTTGAACTGGG - Intergenic
1137608429 16:49802499-49802521 CCTGTTTGGTAGCTTGATGTTGG - Intronic
1137653002 16:50136422-50136444 CAGCTTTAGTAGCTTCCACTTGG + Intergenic
1137848675 16:51716336-51716358 CTACTTTGGTAGCTTGAAATGGG - Intergenic
1140339929 16:74147582-74147604 TAGCTTTGAAATCTTGATCTTGG + Intergenic
1140506476 16:75476672-75476694 CAGCACTGGTGGCTTGATCTTGG + Exonic
1143486973 17:7260698-7260720 CCGCCTTGGTAGCTTGCTCCTGG - Exonic
1144308874 17:13994233-13994255 TTGCCTTGGTAGCTTGAACTTGG - Intergenic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1152327774 17:79651544-79651566 CATCTTCTGTAGCTTAATCTCGG - Intergenic
1155103948 18:22642029-22642051 CTGCTTTTTTAGATTGATCTTGG - Intergenic
1156428600 18:37045043-37045065 CAGATTTGGAAGATTGACCTGGG + Intronic
1156834825 18:41539987-41540009 GAGCTGTGGTAGCTATATCTAGG - Intergenic
1159599071 18:70411420-70411442 CAGCCCTGGCACCTTGATCTGGG + Intergenic
925091851 2:1162748-1162770 CAGCTTTGGTAGTTTTCTCCAGG + Intronic
927294209 2:21434945-21434967 CAGATTTGGTATTTTGATTTGGG - Intergenic
927751825 2:25676289-25676311 CAGCTTTGTTTGTTTGTTCTGGG + Intergenic
928339824 2:30433330-30433352 CACCTTTGGTAGCCAGAACTGGG + Intergenic
929592725 2:43157691-43157713 CAGCTTCTGTAGCTGGAACTGGG + Intergenic
930789799 2:55313407-55313429 TAGTTTTTGTAGCTTGATCAAGG + Intronic
931679645 2:64734764-64734786 GAGCTTTTGGATCTTGATCTTGG + Intronic
932105611 2:68938514-68938536 CAGCTATGGTAGCTTTGCCTTGG + Intergenic
932559641 2:72855841-72855863 CAGCTGAGGTAGCTTGAAATTGG - Intergenic
933613216 2:84458889-84458911 CAAATTTGGGAGCTTGCTCTCGG - Intronic
937631311 2:124104832-124104854 CAGCTTTGGTAGCTGGTACTCGG + Intronic
938806593 2:134811950-134811972 CAGCTTTGGAAACTTAATTTGGG + Intergenic
940051785 2:149472759-149472781 GAGCTTTGGTACCTTCATTTGGG - Exonic
941599844 2:167528869-167528891 CAGCTTTGTACCCTTGATCTTGG + Intergenic
941701153 2:168605759-168605781 AAGCCTTGGTAGCTTCCTCTTGG + Intronic
945258301 2:207820689-207820711 GAGCTTTGGCAGCTTTGTCTTGG + Intergenic
945520137 2:210816972-210816994 CAAATTTGGTAGTATGATCTAGG + Intergenic
947758621 2:232587463-232587485 CAGCTTTGGGAGCTTGAGGCAGG - Intergenic
1172077604 20:32311171-32311193 CGGGTATGGTACCTTGATCTTGG - Exonic
1172742140 20:37177329-37177351 TAGTATTGGTAGCTTGATTTTGG - Intronic
1174248167 20:49197754-49197776 CAGTCTGGATAGCTTGATCTTGG + Intergenic
1178913584 21:36694819-36694841 CAGCTTTGGTCGCTCGCTCAAGG + Intergenic
1181681383 22:24498062-24498084 CTGCTGTGGCACCTTGATCTTGG - Intronic
949657676 3:6239510-6239532 CAGCTTTGGTAGCCATATTTTGG - Intergenic
952789782 3:37190589-37190611 CAGTATTGGTAGCTGGAACTTGG + Intergenic
952957316 3:38565210-38565232 CAGCCTTGGTAGCTTCAACCTGG + Intronic
953049860 3:39331274-39331296 CTGCATTGGCAGCTTGGTCTTGG - Intronic
953278937 3:41533163-41533185 GTGCTTTGGCAGCATGATCTGGG - Intronic
957321195 3:78632682-78632704 CAGCTTAGATACCTAGATCTGGG - Intronic
958526959 3:95274016-95274038 CAGCTTGGGTAGCTAAATTTTGG + Intergenic
959383323 3:105669407-105669429 GAATGTTGGTAGCTTGATCTTGG + Intronic
959716512 3:109439331-109439353 AATCTTTGGCACCTTGATCTTGG + Intergenic
959902967 3:111680425-111680447 CAGCCTTGGTAGATTCAGCTTGG - Intronic
961625394 3:128259001-128259023 TAGCTTTGGTAGCTTGTTCCAGG - Intronic
961950174 3:130741337-130741359 CAACCCTGTTAGCTTGATCTTGG + Intronic
965148698 3:164942013-164942035 CACCTGTGGTACCTTGACCTCGG + Intergenic
970381834 4:15516210-15516232 CATCTTTGCTAGCTAGATCTGGG + Intronic
970468854 4:16355775-16355797 CCGTGTTGGTACCTTGATCTTGG - Intergenic
971599832 4:28578195-28578217 TATCCTTGGTAGCTTGAACTTGG - Intergenic
974024571 4:56722072-56722094 CAGATGTGGTACTTTGATCTTGG + Intergenic
977361998 4:96016939-96016961 CAGCTTTGTTTGGCTGATCTGGG - Intergenic
977423106 4:96828645-96828667 GAGCTTTGGAAGCTTGAGGTAGG - Intergenic
980317595 4:131222716-131222738 CAGCTTTGGTTTCTAGATCTGGG - Intergenic
984007802 4:174334583-174334605 CAGCTTAGCTGGCTTGTTCTTGG + Intergenic
984824240 4:183910008-183910030 CAGATTTGGTAGCATGAGTTGGG - Intronic
987693332 5:21296819-21296841 CAGCTGTGATGGCTAGATCTGGG + Intergenic
989516705 5:42352556-42352578 CAAATTTGGTATCTTGATATAGG + Intergenic
991106613 5:62851272-62851294 CAACTGTGGTAGATTGAGCTGGG + Intergenic
991746942 5:69752733-69752755 CAGCTCTGATGGCTAGATCTGGG - Intergenic
991750763 5:69802509-69802531 CAGCTCTGATGGCTAGATCTGGG + Intergenic
991798544 5:70332675-70332697 CAGCTCTGATGGCTAGATCTGGG - Intergenic
991826319 5:70628045-70628067 CAGCTCTGATGGCTAGATCTGGG - Intergenic
991830052 5:70677406-70677428 CAGCTCTGATGGCTAGATCTGGG + Intergenic
991890875 5:71331998-71332020 CAGCTCTGATGGCTAGATCTGGG - Intergenic
992058723 5:73020359-73020381 GAGCTTTGCTGGCTTGTTCTTGG + Intronic
993319099 5:86450924-86450946 GAGCTTAAGTAGCTTGACCTAGG + Intergenic
999427178 5:151498493-151498515 CCGCTTTGGAAACGTGATCTTGG - Intergenic
999514517 5:152287571-152287593 CAGATGTGGTTCCTTGATCTTGG + Intergenic
1003255549 6:4471871-4471893 CAGTTTTGATAGTTTGATGTGGG - Intergenic
1008491607 6:52092483-52092505 CGTCATTGGTAGCTTGATATGGG + Intergenic
1009848256 6:69161940-69161962 GAAATTTGGTAGCTTAATCTTGG + Intronic
1013384661 6:109614192-109614214 CAACTTTAGCAGCTTGATCATGG + Exonic
1013643639 6:112113327-112113349 CAGCTTTTGCAGCTGGAACTTGG - Intronic
1018054313 6:160038692-160038714 CAGCTATGGTAGCTGCCTCTGGG + Intronic
1020020510 7:4864216-4864238 GACCTATGGTAGCTTCATCTTGG + Intronic
1026924812 7:74183524-74183546 CACCTTAGCTAGCTTGATGTAGG - Intronic
1027193177 7:76009824-76009846 CAGCTGTGGTGGCTTAAGCTTGG - Intronic
1028787878 7:94817189-94817211 CAGTTTTGGTAGCATGGTTTTGG + Intergenic
1032700548 7:134374892-134374914 CAGCTGTGGTAGCTGGGGCTTGG + Intergenic
1034394216 7:150808017-150808039 CAGCTGGGGAAGCTTGAACTGGG + Intergenic
1040920826 8:52614667-52614689 CAGCTGTGGTAGCCTAATGTGGG - Intergenic
1043226829 8:77744030-77744052 AAGCTTTGCTAACTTGATTTGGG + Intergenic
1043975062 8:86575482-86575504 CAGTTTTATTAGCTTGCTCTTGG - Exonic
1044209660 8:89535709-89535731 CAGCCTGGGAAGCTTGAACTGGG + Intergenic
1046663359 8:116973157-116973179 CAGATGTGGTACCTTGATCTTGG + Intronic
1048323984 8:133424804-133424826 AAACTTTGGTAGCTTGAAATTGG - Intergenic
1052800051 9:32958273-32958295 CAGCTGGGGAAGCTTGAACTGGG + Intergenic
1055027484 9:71737615-71737637 GAGCTTTGGGAGCTTGAAGTGGG - Intronic
1055664394 9:78538998-78539020 GAGCTTTGGTAGCTTGAATAGGG + Intergenic
1056012923 9:82351513-82351535 CAGTTTGGGCAGCTTTATCTGGG - Intergenic
1057156514 9:92846114-92846136 CATCTTTGGTTACTTGATATTGG - Exonic
1057613129 9:96564727-96564749 AATCATTGTTAGCTTGATCTGGG - Intronic
1058684074 9:107465650-107465672 CAACTTTGGTAGCTTCAACAGGG + Intergenic
1059761737 9:117344298-117344320 CAGGTTTGGGAGCTAGAGCTAGG + Intronic
1061830750 9:133292787-133292809 GAGCTTTGCTAGGTTGATATTGG - Intergenic
1187296458 X:18006053-18006075 AACCTTTGGTAGCTTGAAATGGG - Intergenic
1188023988 X:25189140-25189162 CAACCTTTGTAGCTTGAACTTGG + Intergenic
1188884085 X:35528492-35528514 CAGTATTGATAGCTTGATCTTGG + Intergenic
1189253302 X:39618141-39618163 AACCTTTGGTATCTTGATTTGGG + Intergenic
1190808949 X:53864842-53864864 CAGCTTTGGGAGTGTGACCTGGG + Intergenic
1199384579 X:147208637-147208659 GAGCTTTGGTAGCTTCCACTTGG + Intergenic
1199911817 X:152295350-152295372 CAGCTGGGGAAGCTTGAACTGGG - Intronic
1200714053 Y:6517689-6517711 GCACTTTGGGAGCTTGATCTAGG + Intergenic
1201019771 Y:9643465-9643487 GCACTTTGGGAGCTTGATCTAGG - Intergenic