ID: 1150814457

View in Genome Browser
Species Human (GRCh38)
Location 17:68381880-68381902
Sequence TCCCTAGGTTTAGTGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150814451_1150814457 13 Left 1150814451 17:68381844-68381866 CCAGTGATTCTAATACATATTCA 0: 1
1: 0
2: 6
3: 26
4: 299
Right 1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG 0: 1
1: 0
2: 2
3: 8
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150814457 Original CRISPR TCCCTAGGTTTAGTGAGTGA GGG Intronic
900851442 1:5146158-5146180 TCCCTTGCCTTAGTGAGGGAGGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904292479 1:29497055-29497077 TCTCTGGGTTTGATGAGTGAAGG - Intergenic
905361715 1:37425388-37425410 TCCCTAGAGTGAGAGAGTGAGGG - Intergenic
905661578 1:39730321-39730343 TCCTTAGTTTTAGTCAGTCAGGG + Intronic
907601117 1:55770623-55770645 CCCCTAGGTCTAGTTAGTGCAGG + Intergenic
910193091 1:84614138-84614160 CCCCTAGATTTAGTCAGTCAGGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912165267 1:107036005-107036027 TCCCTAGTTTTAGTCAGTCAGGG - Intergenic
912706436 1:111918539-111918561 TCCATAGCTATAGTGAGTGCTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916084922 1:161261535-161261557 TCCCTAGTTTCAGTGAAGGATGG + Intronic
919256846 1:195137181-195137203 CCCCTAGTTTTAGTCAGTGAGGG + Intergenic
924080625 1:240393991-240394013 TCCCTAATTTTAGTTAGTCAGGG - Intronic
1063496245 10:6511601-6511623 TCCCTAGTTTTAGTTGGTCATGG - Intronic
1067008392 10:42687528-42687550 ACCCTAGTTTAAGTGAGTCAAGG - Intergenic
1067922174 10:50470508-50470530 TCTCTAGCTTTGGTGACTGAAGG + Intronic
1068247119 10:54387740-54387762 CCCCTAGTTTTAGTCAGTGAGGG + Intronic
1072272147 10:93787150-93787172 TGTCTAGGTTTGGTGAGTGATGG - Intronic
1073792222 10:106952134-106952156 CCCCTAACTTTAGTGAGTCAGGG + Intronic
1074730273 10:116365045-116365067 GCCCTTAGTTCAGTGAGTGAGGG + Intronic
1075026946 10:118992432-118992454 TCCCTTGGCTTAGTGATTTAGGG + Intergenic
1077738667 11:4820154-4820176 TCCTCAGCTTTACTGAGTGAAGG + Intronic
1080652610 11:34234607-34234629 TACCTAGGTTTTGTGAGAGGCGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083086286 11:60149943-60149965 TCCCTAGACTAAGTGAGTTAAGG - Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088524209 11:110735179-110735201 TCCCAAGGCTTAGAGAGTCAAGG - Intergenic
1092329243 12:7567386-7567408 TCCCTGGGGTTAGTGATTGGGGG - Intergenic
1093726123 12:22510762-22510784 TCACTAGGTTTCTTGACTGAAGG + Intronic
1095104414 12:38214447-38214469 TCCCAAGTTTTAGAGATTGAAGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099772167 12:87075201-87075223 TCCCTACTTCTAGTGAGCGAAGG - Intergenic
1102865985 12:116374258-116374280 TGCCTAAGGTTAGTGGGTGATGG + Intergenic
1106103494 13:26714358-26714380 TCCCTAAGGTTGGGGAGTGAGGG + Intergenic
1106159651 13:27189508-27189530 ACTCTAGGTTTAGTGAGGGAAGG - Intergenic
1106841459 13:33688875-33688897 TCCCTAGTTTTAGTCCGTCAGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108104663 13:46996290-46996312 TCTCTAGGATTATTTAGTGAAGG + Intergenic
1108583254 13:51845370-51845392 TCCCTAGGTTTAGTGCCTAAGGG - Intergenic
1108752055 13:53457817-53457839 CCCCTAGTTTTAGTCAGTCAGGG - Intergenic
1108843774 13:54653263-54653285 TGCTTAGGTGTAGTGAATGAAGG - Intergenic
1109522146 13:63527603-63527625 GCCCTAGTTTTAGTCAGTCAGGG - Intergenic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1113763967 13:112869384-112869406 TCCCTGGGTTTAGGGGGTAATGG - Intronic
1114614669 14:24062055-24062077 TCCTTTGGTTTGGTGAGTGGTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1123883353 15:24696685-24696707 TCCCTTGGCTTAGTGAGTCTAGG + Intergenic
1124475108 15:30026381-30026403 CCCCTAGTTTTAGTTAGTCAGGG - Intergenic
1127428016 15:58875030-58875052 TCACTAGATTTATTGAGAGAAGG + Intronic
1131927641 15:97403223-97403245 TCCCTAGGTTTTCTGAGGAATGG - Intergenic
1133832553 16:9337426-9337448 TGGCATGGTTTAGTGAGTGAAGG + Intergenic
1134369522 16:13610063-13610085 TCCCTTGGTTTAGTGATTTGGGG - Intergenic
1135075556 16:19390397-19390419 CCCCTAGATTTAGTCAGTCAGGG + Intergenic
1135927136 16:26705390-26705412 TGCCTAGTTTTAGTGGGTCAGGG - Intergenic
1135942398 16:26834007-26834029 CCCCTAGTTTTAGTCAGTCAGGG + Intergenic
1140307123 16:73813563-73813585 TCTCTAGGTTTAATGAAGGAAGG - Intergenic
1140485172 16:75287916-75287938 TGCCTGGGGTTAGGGAGTGAAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145715591 17:27017111-27017133 CTCCTAGTTTTAGTCAGTGAAGG - Intergenic
1146433897 17:32824640-32824662 TCCCCCGGCTTAGTAAGTGATGG + Intronic
1146914082 17:36666952-36666974 TCACTTCATTTAGTGAGTGAGGG + Intergenic
1149099767 17:52890362-52890384 TGCATATGTTTTGTGAGTGATGG + Intronic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1151773399 17:76179952-76179974 GCCCTAGGTCTACTGAGTAAGGG + Intronic
1153815759 18:8788699-8788721 TTCCCAGGTTTAGTGAATGGTGG - Intronic
1154472370 18:14716961-14716983 CTCCTAGTTTTAGTCAGTGAAGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1157206978 18:45709102-45709124 TCCCTACTTTTAGTCAGTGGGGG - Intergenic
1158954897 18:62528271-62528293 TCACTACTTTTAGTAAGTGAAGG - Intronic
1159937152 18:74378349-74378371 TCCCCAGTTTTAGGGAGTGTGGG - Intergenic
1160759395 19:775391-775413 TCCCTGGGGTCAGTGAGTGCTGG + Intergenic
1161595103 19:5147180-5147202 TCCATAGGTTTCTTGAGGGAGGG - Intronic
1162045509 19:7997467-7997489 TCGCTGGGGTTAGGGAGTGAGGG + Intronic
1162218091 19:9153118-9153140 TCCCTAGGTTTAGTGTGTCAAGG + Intronic
1162402549 19:10454616-10454638 TCCCCAGGTTTGGGGAGTCATGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166984653 19:46652644-46652666 TCCCTAGGTAAGGTGGGTGAGGG - Exonic
1168451484 19:56469907-56469929 TACCCCGGTTTAGTGGGTGAGGG - Intronic
1168532642 19:57141971-57141993 CCCCTAGTTTTAGTGAGTTAGGG + Intronic
925179975 2:1811308-1811330 TTCCTAGGTTCAGTGGGAGAAGG + Intronic
925759505 2:7170825-7170847 TCCATGGTCTTAGTGAGTGAAGG + Intergenic
929397113 2:41535704-41535726 CCCCTAGTTTTAGTCAGTCAGGG + Intergenic
936599227 2:113879487-113879509 TCCCTAGGTCTAGCAAATGAGGG - Intergenic
938400289 2:130985473-130985495 CCCCTAGTTTTAGTCAGTCAGGG - Intronic
940480837 2:154228658-154228680 CCCCTAGTTTTAGTCAGTTAGGG - Intronic
942648281 2:178138813-178138835 ACCCTAGGTTAAGTTAATGAAGG + Intronic
943940002 2:193980703-193980725 CCCCTAGTTTTAGTGGGTCAGGG + Intergenic
945440969 2:209879220-209879242 TCCCTAGGTTCCGTGATTGTTGG - Intronic
947484606 2:230536673-230536695 CCCCTAACTTTAGTGAGTCAGGG + Intronic
947589732 2:231378782-231378804 ACCCTGGGTTTACTGAGGGAAGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1170474143 20:16698243-16698265 TCCCCAGTTTTAGTCAGTTAGGG + Intergenic
1176802121 21:13440938-13440960 CTCCTAGTTTTAGTCAGTGAAGG - Intergenic
1177640601 21:23839924-23839946 TCCCTAATTTTAGTCAGTCAGGG - Intergenic
1178511390 21:33207714-33207736 TCCCTAGCATTGGTGAGGGAAGG - Intergenic
1183062005 22:35341934-35341956 TCTCACGGTTTAGTGGGTGAAGG - Intronic
1183226039 22:36550622-36550644 TCCCAAAGTTTGCTGAGTGAAGG - Intergenic
1185167194 22:49268940-49268962 TCCCTAGGACTACAGAGTGAGGG + Intergenic
949672262 3:6412725-6412747 GCCCTAGCTTTAGTCAGTGGGGG + Intergenic
950245421 3:11412133-11412155 GCCCTAGTTTTAGTCAGTCAGGG - Intronic
950470039 3:13179080-13179102 CCCCTAGTTTTAGTCAGTTAGGG + Intergenic
950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG + Intergenic
952907822 3:38154602-38154624 TTCCTGGGTTTAGATAGTGATGG + Intergenic
952978943 3:38719791-38719813 TCCTTAGGATTAGTGCTTGAAGG - Intronic
959638352 3:108601928-108601950 CCCCTAGTTTTAGTCAGTCAGGG + Intronic
960678279 3:120219243-120219265 TCCCTAGGAGGAGTGAATGAGGG + Intronic
961760405 3:129162961-129162983 TCCCTAGGCATAGTGACTGGTGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966828142 3:183982763-183982785 TCCCTGGGTGAGGTGAGTGAGGG - Exonic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
974066208 4:57080064-57080086 TCCCACGGTTTTCTGAGTGATGG + Intronic
983053978 4:163080725-163080747 TCCCTTGGCTTAGTGATTTAGGG - Intergenic
984624005 4:181985460-181985482 TCTCTTGGTTTTGTGAATGAGGG + Intergenic
985270215 4:188187196-188187218 TCCCTAGTTGTAGTCAGTCAGGG + Intergenic
986293201 5:6416818-6416840 TCCCTAGAATTAGAGAGTGTAGG - Intergenic
986923363 5:12716347-12716369 CCCCTAGCTTTAGTCAGTCAGGG - Intergenic
987907699 5:24098894-24098916 TCTCAAAGTTTAGTGAGTAAGGG - Intronic
988039592 5:25872625-25872647 CCCCTAGTTTTAGTCAGTCAGGG + Intergenic
989559060 5:42830169-42830191 CCCCTAGTTTTAGTCAGTTAGGG + Intronic
991178795 5:63724215-63724237 CCACTAGGCTTAGTGAGTGTGGG - Intergenic
992125656 5:73637322-73637344 TCCCTAAGTTTCTTGAGAGAAGG - Intronic
993583859 5:89698983-89699005 TTCCAAGGTTTAGAGAGGGAAGG - Intergenic
996785956 5:127236947-127236969 CCCCCAGATTTAGGGAGTGATGG + Intergenic
1000540853 5:162538124-162538146 CCCCTAGTTTTAGTCAGTCAGGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005114902 6:22325207-22325229 TCCTAAAGTTTAGTGAGTGTGGG + Intergenic
1005615439 6:27568094-27568116 TCCCTTGGTTTAGTGATTTTGGG - Intergenic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1011943114 6:92867826-92867848 AGTCTAGGTTTAATGAGTGAGGG - Intergenic
1013603365 6:111725829-111725851 TCCCTAGGATTTATGAATGATGG + Intronic
1014046690 6:116897076-116897098 TAACTAGGTTTAGGGAGTTAAGG + Intronic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1017383682 6:153858802-153858824 CCCCTACGTTTAGTCAGTTAGGG + Intergenic
1017818832 6:158034390-158034412 GCCCTGTGTTTACTGAGTGAAGG + Intronic
1018098593 6:160415941-160415963 TCCAGAGCTTTAGTGAGAGAAGG + Intronic
1022860872 7:34365234-34365256 TTCCTAACTTTGGTGAGTGATGG - Intergenic
1026256802 7:68719309-68719331 TCTCTAGGTTCTGTGGGTGAAGG + Intergenic
1027658605 7:80962127-80962149 CCCCTAGTTTTAGTGGGTAAGGG + Intergenic
1027984732 7:85272636-85272658 TACCTATGTTTAGTCTGTGAAGG - Intergenic
1032719549 7:134539373-134539395 TCCATAGGCTTAGGGAGGGAGGG + Intronic
1033613342 7:142987016-142987038 TCCTCAGGTTTAGTCAGTGGAGG - Intergenic
1036547998 8:9790773-9790795 TCCCTTGGCTTAGTGATTTACGG - Intergenic
1040028542 8:42803629-42803651 CCCCTAGTTTTAGTGGGTCAGGG + Intergenic
1042094543 8:65199069-65199091 TTCCTGGGTTTATTGTGTGATGG - Intergenic
1042397278 8:68306994-68307016 CCCCTAGTTTTAGTGGGTCAGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043614823 8:82112949-82112971 TCCCTAATTTTAGTCAGTCAGGG - Intergenic
1043957550 8:86378906-86378928 TTCTTAGGATTGGTGAGTGAAGG - Intronic
1044018528 8:87075592-87075614 CTCCTAGCTTTAGTGAGTCAGGG + Intronic
1044325558 8:90853861-90853883 TCCCTATTTTTAGTGGGTTAGGG - Intronic
1044928725 8:97231810-97231832 TCCCTAAATTCAGTGGGTGAAGG - Intergenic
1045012531 8:97970639-97970661 TCCCTAATTTTAGTCAGTCAGGG - Intronic
1045574689 8:103407775-103407797 TCCCTTGATGCAGTGAGTGATGG - Exonic
1046280316 8:112020517-112020539 TACCTAGGTATATTGTGTGATGG - Intergenic
1048125620 8:131632153-131632175 TCCATAAGTTTAGTGGGAGAGGG - Intergenic
1048621291 8:136135413-136135435 TCCCTAGGTTTAGTCAGTCAGGG + Intergenic
1050127192 9:2369381-2369403 TCCCAAGGTTTGGAGAGAGATGG + Intergenic
1050498743 9:6271800-6271822 TCTTTAGGTTTAGTGTGTTAAGG - Intergenic
1051136129 9:13923623-13923645 CCCCTAGTTTTAGTCAGTCAGGG - Intergenic
1052440738 9:28493677-28493699 TCCCTAGGTGTTGTCTGTGAGGG + Intronic
1056972983 9:91224022-91224044 CCCCTAGTTTTAGTGGGTTAGGG + Intronic
1058500280 9:105607902-105607924 ACTCTAGGTTTATTGAGTGTAGG + Exonic
1061310356 9:129758145-129758167 TGGCTGGGCTTAGTGAGTGAGGG - Intergenic
1061794046 9:133073735-133073757 TCCATAGTTTTGCTGAGTGAAGG + Intronic
1062186909 9:135223162-135223184 TCCCTCCATTTGGTGAGTGAAGG + Intergenic
1062211790 9:135368619-135368641 CCCCTAGTTTTAGTCAGTCAGGG + Intergenic
1185917478 X:4051671-4051693 CCCCTAGTTTTAGTCAGTCAGGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194092448 X:89595369-89595391 TCCCTTGGGTAAGTGAGTAAGGG + Intergenic
1198256017 X:134925041-134925063 CCCCTAGTTTTAGTGGGTCAGGG - Intergenic
1198948069 X:142037853-142037875 TCCTTAGCTTTTGTGATTGAAGG - Intergenic
1199845065 X:151686862-151686884 TCCCTGGTTCTAGTGAGGGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200445084 Y:3251405-3251427 TCCCTTGGGTAAGTGAGTAAGGG + Intergenic