ID: 1150818823

View in Genome Browser
Species Human (GRCh38)
Location 17:68418146-68418168
Sequence AATTGTAAGCTGGACATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150818816_1150818823 28 Left 1150818816 17:68418095-68418117 CCTTATGTGCCAGACTAGAAACT 0: 1
1: 0
2: 5
3: 27
4: 161
Right 1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG 0: 1
1: 1
2: 2
3: 18
4: 196
1150818820_1150818823 -3 Left 1150818820 17:68418126-68418148 CCTATTTAGTCGTCCTTAAAAAT 0: 1
1: 0
2: 0
3: 12
4: 222
Right 1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG 0: 1
1: 1
2: 2
3: 18
4: 196
1150818819_1150818823 19 Left 1150818819 17:68418104-68418126 CCAGACTAGAAACTGGGAGTCTC 0: 1
1: 0
2: 0
3: 18
4: 123
Right 1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG 0: 1
1: 1
2: 2
3: 18
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150818823 Original CRISPR AATTGTAAGCTGGACATTGT TGG Intronic
903273224 1:22205027-22205049 AGATGTGAGCTGGACAGTGTGGG + Intergenic
904744025 1:32700134-32700156 AATTCTCAGCTGGACACCGTGGG - Intronic
904912599 1:33946772-33946794 AAAAGTTAGCTGGACATGGTGGG - Intronic
905977229 1:42185120-42185142 ATATTTAAGCTGGACTTTGTAGG - Intronic
907914020 1:58852585-58852607 AATAGTAATCTGGACCTTGTGGG - Intergenic
908498900 1:64723239-64723261 AATTAAAAGGTGGAAATTGTGGG + Intergenic
908696618 1:66849483-66849505 AATTGAAACCTGGACATTTGGGG - Intronic
909959396 1:81820756-81820778 AAGTGTAAGCAGAATATTGTGGG - Intronic
910266433 1:85342747-85342769 GATTGTAAGCTGGGCACTTTTGG + Intronic
911589687 1:99732363-99732385 AACATTAAGCTGGACACTGTGGG + Intronic
913149566 1:116027252-116027274 CATTGTAACCTTCACATTGTTGG + Intronic
913191616 1:116418089-116418111 ATTTGTAAGCTGGAGTTAGTAGG - Intergenic
914349428 1:146827279-146827301 AACTGAAACCTGGACATTTTGGG - Intergenic
914509986 1:148323291-148323313 AATTGTAGGCTGGAGTTTGAGGG + Intergenic
915742507 1:158129889-158129911 AATTGTACACTGGACATTTTGGG + Intergenic
915807811 1:158873017-158873039 AATTGTAAGCTGGAGACCCTGGG + Intergenic
916541988 1:165765754-165765776 AACAGCAAGCTGGACAGTGTGGG + Intronic
916756731 1:167777989-167778011 CATTGTAAATTGTACATTGTTGG - Intronic
917505269 1:175621667-175621689 AAATTTGAGCTGGACATTGAAGG - Intronic
917843065 1:178998457-178998479 AAGGTTAAGGTGGACATTGTTGG - Intergenic
918034436 1:180853583-180853605 AATTGAAAACTGGACAGTTTGGG + Intronic
918687906 1:187442597-187442619 AATTGTAAGATGGATATTTGGGG - Intergenic
919261411 1:195199042-195199064 TAATGGAAGCTGGACATTATTGG + Intergenic
919501814 1:198346842-198346864 AACTGTCACCTGGACATTTTGGG + Intergenic
920281123 1:204844455-204844477 AATTGTACGCTAGATACTGTGGG + Intronic
920891373 1:209989380-209989402 AATTGGAAATTGGACAATGTAGG + Intronic
921044755 1:211467541-211467563 AATTATAAGCTGGGCGTGGTGGG - Intergenic
921658544 1:217770466-217770488 AATTGTGATCTGGGAATTGTAGG + Intronic
921849498 1:219919623-219919645 AAAAATTAGCTGGACATTGTGGG + Intronic
1063303117 10:4871380-4871402 AATTAAAACCTGGACATTTTGGG + Intergenic
1063875438 10:10472634-10472656 AGTTGTAAACTAGACATTGAAGG + Intergenic
1066488683 10:35873284-35873306 AATTGTAAGAAGGGCATTGCAGG + Intergenic
1067245225 10:44535989-44536011 TATTGTACACTGGACATTTTTGG + Intergenic
1067245451 10:44537953-44537975 TATTGTACACTGGACATTTTTGG + Intergenic
1068792991 10:61047792-61047814 AATAGTAAGTTGGAAAGTGTAGG - Intergenic
1068916803 10:62441727-62441749 AGTTATTTGCTGGACATTGTAGG - Intronic
1069359006 10:67620712-67620734 AAATGTGAGGTGGACAATGTGGG + Intronic
1071134898 10:82442344-82442366 AATTGTAAGGTGGAATTTGAAGG + Intronic
1074757513 10:116635886-116635908 AATTTTAACCTTGACATTCTTGG + Intronic
1075907258 10:126092455-126092477 AATTGTTTGCTGGACATTTGGGG - Intronic
1078503666 11:11910837-11910859 AATTGAAACCTGGACATTTGGGG - Intronic
1078779770 11:14426183-14426205 TATTGTAAGCTTTACATTGTTGG - Intergenic
1079244512 11:18742891-18742913 ACTTATAGGCTGGACATTCTGGG - Intronic
1081290025 11:41313272-41313294 TATTGTTTGCTAGACATTGTTGG - Intronic
1087135660 11:94716415-94716437 ACTTGTACCCTGGACATTTTGGG + Intronic
1087854108 11:103069910-103069932 AATTGAAACCTGGATATTTTGGG - Intronic
1088640420 11:111867709-111867731 AGTTGAAAGCTGGACATTTTAGG + Intronic
1091074624 11:132603880-132603902 AATTGGAAGCTGGATCTTATAGG - Intronic
1093866920 12:24238502-24238524 AAAAATAAGCTGGACATTGGCGG - Intergenic
1094260708 12:28495343-28495365 AATTTTAAGTTGGACTTTTTTGG + Intronic
1098351884 12:69571479-69571501 AGTTGTAAGCTATAGATTGTGGG + Intronic
1099443376 12:82724963-82724985 AATTGTAGGCTGATCACTGTAGG + Intronic
1102732796 12:115127936-115127958 AATTGTAAGACAGAGATTGTTGG - Intergenic
1105268926 13:18852172-18852194 AAATGTAAGCTGTGCATTTTAGG - Intergenic
1106501364 13:30332120-30332142 ACTTGTAAACTGGACACTTTAGG - Intergenic
1106501572 13:30334286-30334308 ACTTGTAAACTGGACACTTTAGG + Intergenic
1109673927 13:65647963-65647985 GATTGTAACCTGCACATTTTGGG + Intergenic
1109743000 13:66580663-66580685 AATGCTAAGCTGTACAGTGTGGG - Intronic
1110571231 13:77006759-77006781 AAATGTAAACTTGACATTTTAGG - Exonic
1110728284 13:78851836-78851858 AATTGTCAGCTGGCTATGGTGGG - Intergenic
1114332529 14:21651916-21651938 GATTGTAGCCTGGACATTATGGG + Intergenic
1116721749 14:48505076-48505098 TATTGTCAGCTGGATAATGTGGG - Intergenic
1116783601 14:49264544-49264566 AATTGTAAGTTGGATATATTGGG - Intergenic
1116829999 14:49709773-49709795 AATGGAAAGCTGTACATTTTTGG + Exonic
1116987184 14:51232878-51232900 CATTGAAAACTGGACATTTTAGG - Intergenic
1117653333 14:57928642-57928664 TATTGAAACCTGGACATTTTTGG - Intronic
1118585296 14:67346805-67346827 AATTATAAGCAGTGCATTGTGGG + Intronic
1120597240 14:86456136-86456158 AATTCTACTCTGAACATTGTGGG - Intergenic
1122327117 14:100889451-100889473 AAATGGAAGCTGGAAACTGTAGG - Intergenic
1124723199 15:32131744-32131766 AATTATATCCTGGACATTTTGGG + Intronic
1125252139 15:37716887-37716909 TATTGTAAGTTTTACATTGTTGG - Intergenic
1125646238 15:41275131-41275153 AATTGGAAGTTGTACATTTTAGG - Intronic
1126283826 15:46987888-46987910 AATTGTCATCTGGCCATTTTGGG + Intergenic
1128141501 15:65304026-65304048 AATTTTAAACAGGACATTGCCGG + Intergenic
1128777530 15:70334623-70334645 AAATGTATACTGGACATCGTGGG + Intergenic
1128867661 15:71126528-71126550 CATTGAAACCTGGACATTTTAGG - Intronic
1130864882 15:87924393-87924415 GATTCTAAGCTGGAGATTCTGGG - Intronic
1131076537 15:89498869-89498891 ACTTGTGAAGTGGACATTGTAGG + Intergenic
1131474298 15:92723444-92723466 AACTGTATACTGGACATTGTGGG - Intronic
1132534308 16:469959-469981 AAAAATCAGCTGGACATTGTGGG - Intronic
1133403435 16:5505154-5505176 CAATGAAAGCTTGACATTGTAGG + Intergenic
1138453678 16:57108487-57108509 AGTTGGAACCTGGCCATTGTTGG + Intronic
1138546174 16:57721286-57721308 AACTGTAAACTGGACCTTTTAGG - Intronic
1139984608 16:70888275-70888297 AACTGAAACCTGGACATTTTGGG + Intronic
1140740363 16:77936183-77936205 AATAGCAAGCTGGACATTCCTGG + Intronic
1148843668 17:50515778-50515800 ATTTATAAGCTGGACAGTCTTGG - Intronic
1150382447 17:64731507-64731529 AATTGTGGGCTGGGCATAGTGGG - Intergenic
1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG + Intronic
1150951152 17:69802958-69802980 TATTTTAAGCTGGAAAGTGTAGG + Intergenic
1152775436 17:82198649-82198671 AATTGTATCCTGGACATTTTGGG - Intronic
1154252334 18:12755124-12755146 AATTGCCACCTGGACATTTTGGG - Intergenic
1155592369 18:27441807-27441829 AATTATCAGTTGGAAATTGTAGG + Intergenic
1155635048 18:27942739-27942761 AGTTGTAAGCTGAACAATTTTGG - Intergenic
1156696671 18:39775864-39775886 AACTGTAAACAGGACAATGTGGG + Intergenic
1157501771 18:48195630-48195652 AACTGAAAACTGGAAATTGTAGG - Intronic
1159345008 18:67190115-67190137 AATTGTAACCTGGAACCTGTAGG + Intergenic
1160589008 18:79929498-79929520 TGTTGCAAGCTGGACATTTTAGG - Intronic
1164569944 19:29366520-29366542 AAATGTGAGATGGACAATGTAGG - Intergenic
924999331 2:392541-392563 AACTGAAAGCTGGACATGCTGGG - Intergenic
926548882 2:14276495-14276517 AATTGTGACCTGGACATTGTAGG + Intergenic
928146992 2:28787618-28787640 AATTGTAAGTGGCACATTTTTGG + Intronic
928268987 2:29837779-29837801 GATTGTATGCTAGACATTATTGG - Intronic
928500985 2:31895001-31895023 AATTTTAAGCTTGGCTTTGTAGG - Intronic
928780167 2:34808650-34808672 AAGTGTAGGCTGGAGAATGTGGG - Intergenic
929132858 2:38595542-38595564 ACTTAAAAGCTGGACAATGTGGG + Intronic
929414629 2:41734902-41734924 AATTGAAAGCAGGACAGTGGAGG + Intergenic
932867146 2:75355711-75355733 ATTTGTAAGCTGGAGATCCTGGG + Intergenic
933439646 2:82296411-82296433 AATTGAAAGCTTGACTCTGTTGG - Intergenic
935569896 2:104648277-104648299 AATTTTAAGCTGGACTCTGTAGG + Intergenic
935683686 2:105664032-105664054 AATTAAAAGGTGGATATTGTTGG - Intergenic
936002240 2:108844608-108844630 AATTGAAAACTAGACATTTTGGG + Intronic
939723065 2:145679226-145679248 AAATGGAAGCTTGACATTCTTGG + Intergenic
944016059 2:195039646-195039668 AAATGTAAACTGGACTTTCTGGG + Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
1168822509 20:784837-784859 AATTGAAAGGGGGAAATTGTAGG - Intergenic
1170202727 20:13761500-13761522 AAATGTAGGCTGAATATTGTTGG + Intronic
1171850151 20:30302158-30302180 AAATGTAAGCTGGACTGTGGAGG - Intergenic
1173978343 20:47204213-47204235 CAATGTAATCTGGACATTGTTGG + Intergenic
1176854204 21:13951471-13951493 AAATGTAAGCTGTGCATTTTAGG - Intergenic
1181624161 22:24111785-24111807 CATTGTAAGTTGGAGATTGTCGG + Intronic
1182568627 22:31219010-31219032 AAATTTAAGGTGAACATTGTGGG + Intronic
1182909833 22:33972896-33972918 AAGTGAAAACTTGACATTGTTGG + Intergenic
1183657054 22:39192407-39192429 TATTGAAAACTGGACATTGTGGG - Intergenic
950724377 3:14907040-14907062 AGTTGTAAGGTGAACATTGTGGG - Intronic
952038705 3:29235519-29235541 AATTATAGTCTGGACATGGTGGG - Intergenic
952364163 3:32660276-32660298 AATTGAAATCTGTACATTGCTGG - Intergenic
952638033 3:35555376-35555398 AATTGAGAGCTAGACACTGTTGG + Intergenic
953996789 3:47525979-47526001 TATTGGAAACTGGACATTTTAGG - Intergenic
956213562 3:66825953-66825975 AGTTGTAAGATGGACTTTGAAGG - Intergenic
957546495 3:81644792-81644814 AATTGCAAGTTGGACATGGGTGG + Intronic
957841293 3:85673286-85673308 ATTTGCAAGCTGAATATTGTTGG - Intronic
958726486 3:97911491-97911513 AACTGTAAGCTGCACATTTAAGG + Intronic
959088072 3:101872546-101872568 AATTGTATGCTGGACATTGTTGG + Intergenic
960066863 3:113383568-113383590 AATTTTAAGCTGGATATGGAAGG + Intronic
963853979 3:150235433-150235455 AGGTGTAAGCTGGACCTTGGAGG + Intergenic
964461056 3:156928923-156928945 GATTGTATACTGAACATTGTGGG - Intronic
964644323 3:158942336-158942358 AATGGTAAACCGAACATTGTAGG + Intergenic
966422591 3:179747987-179748009 AATTGAAAACTGGTCCTTGTGGG + Intronic
966702419 3:182869852-182869874 ACTTGTTAGCTGGACATTTGGGG - Intronic
967314125 3:188134791-188134813 AATTTTTAGCTGGGCATGGTGGG - Intergenic
970335225 4:15031858-15031880 ACATGTAAGATGGAGATTGTCGG - Intronic
970837929 4:20433473-20433495 AATGGTAGGCTGCACAGTGTTGG + Intronic
973792708 4:54393156-54393178 AATTGTATGATGGAAGTTGTAGG - Intergenic
974084997 4:57250529-57250551 AATTGTAATCTCTCCATTGTTGG - Intergenic
975202177 4:71604477-71604499 AAGTATTAGCTGGACATTATAGG - Intergenic
976300875 4:83514391-83514413 AGTTGTAAGCTGGAGATCCTGGG + Intronic
976788472 4:88849878-88849900 AATTGTAAACTGGAATTAGTTGG - Intronic
977443017 4:97094444-97094466 GATTGTATCCTGGACATTTTGGG + Intergenic
978630404 4:110737737-110737759 AACTGTAGGATGCACATTGTGGG - Intergenic
979916377 4:126439630-126439652 AATTATAAGCAGTACATTGAGGG + Intergenic
981190896 4:141861276-141861298 AATTGAAACCTGGATATTTTGGG - Intergenic
981804027 4:148691757-148691779 AACTGTAAGCTGGACACTGAGGG - Intergenic
982167616 4:152629029-152629051 AATTGTAAGCTGGACACCATTGG - Intronic
984155525 4:176191798-176191820 AATTGTGAGATGGATATTTTAGG - Intronic
985238654 4:187905274-187905296 AACTGTAATCTATACATTGTGGG + Intergenic
986034909 5:3927967-3927989 ATTTGCAAGCTGGACCTTCTTGG + Intergenic
988338468 5:29937374-29937396 AATTGTCAGCTAGACAATGAAGG + Intergenic
988731807 5:33979982-33980004 AATTGTAAGCTGGGAAGTGGTGG + Intronic
990086424 5:51983705-51983727 AATTATAAGCTGGAGAATGTTGG - Intergenic
991169931 5:63612593-63612615 AATTATAAGCTGGAATTAGTTGG - Intergenic
991648797 5:68830283-68830305 AGTAGTAAGCTGGTCATTTTGGG - Intergenic
992517374 5:77508661-77508683 TATTGAAAGCTGAACATTTTTGG + Intronic
992804479 5:80323472-80323494 TATTGTATTCTGGACATTTTAGG - Intergenic
993595158 5:89845004-89845026 AATTGTATCCTGGACATTTTGGG - Intergenic
994059144 5:95454976-95454998 ATATGTAAGATGTACATTGTGGG - Intergenic
994602582 5:101925200-101925222 AATATTAAGTTGTACATTGTAGG - Intergenic
995828439 5:116328123-116328145 GATTGTAAGCTGGGCATGGTAGG + Intronic
995940964 5:117583291-117583313 CTTTGTAATCTGAACATTGTAGG + Intergenic
998662509 5:144255446-144255468 AATTGGAACCTGCACACTGTTGG - Intronic
1000596659 5:163222089-163222111 TATTGAAAACTGGACATTTTTGG - Intergenic
1000617963 5:163450892-163450914 ATTTGTAAGTTGGACATTTTGGG - Exonic
1002017188 5:176334209-176334231 TATTGTGTTCTGGACATTGTGGG + Intronic
1003949022 6:11101072-11101094 AGTTGTATGCTGGACCTTTTGGG + Intronic
1004673413 6:17818840-17818862 AATTGTAAGCAAAACATTGGGGG - Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007967869 6:46019247-46019269 AATTAAAAGCTGAAGATTGTTGG + Intronic
1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG + Intronic
1010425521 6:75724924-75724946 ATTTCTAAGACGGACATTGTTGG + Intergenic
1012275879 6:97275119-97275141 TATTGTTAGATGAACATTGTGGG - Intronic
1013071048 6:106729735-106729757 AATTGGAAGTTGGAAATTGAAGG + Intergenic
1013606321 6:111752393-111752415 AATTGTCAGTTGGAAGTTGTAGG + Intronic
1014745018 6:125190732-125190754 TATTGTAAACTGCACATTGAGGG - Intronic
1020816280 7:12909716-12909738 AATTGTAAGTGGAACATGGTGGG + Intergenic
1020822707 7:12989823-12989845 TATTGAAAGCTAGACATTTTAGG - Intergenic
1023011269 7:35926572-35926594 ACTTGTAATCTCAACATTGTGGG - Intergenic
1023919340 7:44615169-44615191 ACTTGCAACCTGGACATTCTGGG + Intronic
1024594705 7:50922325-50922347 AATTCTCAGCTGGGCAATGTTGG - Intergenic
1027343200 7:77231915-77231937 CATTGTAAATTGGACATTTTAGG + Intronic
1027972493 7:85103364-85103386 AATTCTAAACTGGAAATTCTTGG + Intronic
1032607864 7:133376962-133376984 AATTCTATGCTAGACATTGCAGG - Intronic
1036395659 8:8368666-8368688 AAATGTAGGCTGGCCATTCTAGG + Intronic
1041966819 8:63687690-63687712 AAATGAAAGCTGGCCATTGGAGG + Intergenic
1042463776 8:69102452-69102474 TACTGTATGCTGGACATTTTGGG - Intergenic
1043524604 8:81082977-81082999 CATTGAAACCTGGACATTTTGGG + Intronic
1043626322 8:82264445-82264467 AATTAAAAGTTGGAGATTGTTGG - Intergenic
1043945035 8:86240110-86240132 TATTGAAAACTGGACATTTTGGG - Intronic
1044151014 8:88774705-88774727 AATTGCCACCTGGACATTTTGGG + Intergenic
1047388177 8:124428701-124428723 AAAAATTAGCTGGACATTGTGGG - Intergenic
1047643789 8:126848841-126848863 AATTGTGAGGTGCAGATTGTTGG + Intergenic
1049132650 8:140861529-140861551 AAGTGTGAGCTGCACATTATGGG - Intronic
1049395043 8:142396149-142396171 AATGGGAAGCTGGGCATTGGAGG - Intronic
1050348555 9:4717559-4717581 AATTGTAAGCTGGGGATTGTCGG - Intronic
1050772236 9:9216614-9216636 AAGTTAAAGCTGGAAATTGTAGG + Intronic
1052522067 9:29561718-29561740 AATTGTAATCTCCACATTTTGGG + Intergenic
1053487462 9:38470719-38470741 AGTTGTATGCCAGACATTGTTGG - Intergenic
1055438806 9:76319162-76319184 ATATGTAAGATGTACATTGTAGG + Intronic
1055449657 9:76419381-76419403 AAGTGTAAGCTGGGCGTAGTGGG + Intergenic
1057326915 9:94074120-94074142 AACTGTATTCTGGACATTTTGGG + Intronic
1059639594 9:116203784-116203806 ACATGTAAGCTGGACTTTGCAGG + Intronic
1185635515 X:1549035-1549057 AAGTGAAGGATGGACATTGTGGG + Intergenic
1187445355 X:19356096-19356118 CATTCTATGCTGGACACTGTGGG - Intronic
1188981395 X:36730353-36730375 CATTGTCAGTTGGACATTGCTGG - Intergenic
1190839403 X:54130475-54130497 CATTGAAAACTGGACATTTTGGG + Intronic
1195681698 X:107551864-107551886 AATGTTAAGCTGGAAATTGGTGG - Intronic
1195787367 X:108541897-108541919 AATTGCATACTGGATATTGTAGG - Intronic
1197501025 X:127242774-127242796 AATTGTCACCTGGACAACGTGGG + Intergenic
1197511087 X:127370298-127370320 AATGGTAAGCTGAATGTTGTGGG - Intergenic
1197719464 X:129735294-129735316 AATTTTGAGCTGGACTTTGATGG + Intergenic