ID: 1150820973

View in Genome Browser
Species Human (GRCh38)
Location 17:68434069-68434091
Sequence TTCTCACATAAATAAGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150820973_1150820975 13 Left 1150820973 17:68434069-68434091 CCATAGTCTTATTTATGTGAGAA 0: 1
1: 0
2: 2
3: 13
4: 232
Right 1150820975 17:68434105-68434127 GCCCTGCCTCTGTCAGCAGAAGG 0: 1
1: 0
2: 2
3: 41
4: 379
1150820973_1150820977 14 Left 1150820973 17:68434069-68434091 CCATAGTCTTATTTATGTGAGAA 0: 1
1: 0
2: 2
3: 13
4: 232
Right 1150820977 17:68434106-68434128 CCCTGCCTCTGTCAGCAGAAGGG 0: 1
1: 0
2: 2
3: 35
4: 310
1150820973_1150820979 17 Left 1150820973 17:68434069-68434091 CCATAGTCTTATTTATGTGAGAA 0: 1
1: 0
2: 2
3: 13
4: 232
Right 1150820979 17:68434109-68434131 TGCCTCTGTCAGCAGAAGGGAGG 0: 1
1: 0
2: 0
3: 39
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150820973 Original CRISPR TTCTCACATAAATAAGACTA TGG (reversed) Intronic
905176722 1:36140854-36140876 TTCTCACATAAAGAATTCTGGGG + Intronic
907020625 1:51063511-51063533 TACTCACATACATAGGACTGTGG - Intergenic
908285079 1:62588590-62588612 TTCTAACCTAAATATGACTAAGG - Intronic
909750896 1:79159389-79159411 TTATCACATAAACAGAACTAAGG - Intergenic
910474985 1:87596825-87596847 TGCTCACTGAAATAATACTATGG + Intergenic
911280636 1:95923468-95923490 TTCTCATATAAATGAGAATCAGG + Intergenic
916478244 1:165190754-165190776 TTCTCTCTTAAACAAGAGTAAGG + Intergenic
919046725 1:192461958-192461980 TTCTCACATAAAGAATTCCAGGG - Intergenic
919310204 1:195896986-195897008 TTCTAAAATAAAAAAGACCAGGG - Intergenic
923113009 1:230908132-230908154 TGATCATATAAATAAGACTTTGG + Intronic
923637621 1:235716374-235716396 CTATTACATAAATAACACTAGGG + Intronic
923928791 1:238668880-238668902 TACTAAGATAAATAAAACTAAGG - Intergenic
1063598155 10:7456175-7456197 TTCTGAAATAAATAAGGCTGTGG + Intergenic
1064476819 10:15699358-15699380 TTCTCACAAACATAAAACTGAGG - Intronic
1065400842 10:25299333-25299355 TTCTCCAATGAATAAGTCTAGGG - Intronic
1071584015 10:86801714-86801736 GTCTCACAAAAAAAAGAATAAGG - Intronic
1071814113 10:89214047-89214069 TTCTCAGATAAGTAGAACTATGG + Exonic
1072965635 10:99970355-99970377 TTCTTTCATTAATAAGCCTAGGG - Intronic
1073173619 10:101535219-101535241 TTCTCAAACAAATAAAACAAAGG - Intronic
1073537606 10:104291763-104291785 TTCACTGAAAAATAAGACTACGG - Intronic
1074013875 10:109512645-109512667 TTGTCACATAAACAAAACTCAGG - Intergenic
1077607693 11:3623078-3623100 TTCTCTCACAAATAAGACCCTGG + Intergenic
1077910692 11:6569478-6569500 GTCTCAAAAAAAAAAGACTAGGG + Intronic
1079287592 11:19152542-19152564 TTCTCCCTTAAAAAAGAGTAGGG - Exonic
1079545406 11:21627227-21627249 TCCACAAATAAACAAGACTAGGG - Intergenic
1079782906 11:24631490-24631512 GTATCACATAAACAGGACTAAGG - Intronic
1087384112 11:97447907-97447929 TTCTCACATAAACAATAGAATGG + Intergenic
1089078323 11:115756745-115756767 TTCTGACAAACATAAGACTTGGG + Intergenic
1090437615 11:126699891-126699913 TTATCAGATAAATAAAAATAAGG + Intronic
1091880336 12:3972134-3972156 CCCTCAGATAAATAAGACAAAGG - Intergenic
1092884929 12:12916635-12916657 GTTTCACAAAAATAAGACAAAGG - Exonic
1092974925 12:13735703-13735725 TTCAGAAATAAATAAGATTAGGG - Intronic
1094267006 12:28570915-28570937 TTTTCATGTAAAGAAGACTATGG + Intronic
1094318320 12:29156498-29156520 CACTCAGATAAATAAAACTACGG + Intronic
1097085900 12:56468171-56468193 TTCTCACTTAATTATTACTAAGG + Intronic
1098782306 12:74702232-74702254 TTTTCATATATATAAGATTATGG + Intergenic
1102833186 12:116026786-116026808 TTATCCCATATATAAAACTATGG + Intronic
1103041709 12:117701213-117701235 TTCTCACCTAGCTGAGACTATGG + Intronic
1104152885 12:126101639-126101661 TGATCACATAAATAATAGTATGG + Intergenic
1106902903 13:34373250-34373272 TTATGAGATAAATAAGAATAAGG + Intergenic
1106933856 13:34696706-34696728 TTCTAGAATAAGTAAGACTATGG - Intergenic
1107272223 13:38633344-38633366 TTCTGGCAGAAATAAGACTAAGG + Intergenic
1107439637 13:40414256-40414278 TTCCCACAAAAATAAAAATAAGG + Intergenic
1107665286 13:42682316-42682338 TTCTCCACTAAAAAAGACTAGGG + Intergenic
1108477108 13:50831254-50831276 ATGTCACAAAAATAAGATTAAGG + Intronic
1109761891 13:66841439-66841461 TTCTCACATAGTTAAGATCAAGG + Intronic
1109976630 13:69843588-69843610 TTTTTACATAAATAGGACTTGGG + Intronic
1110002428 13:70221267-70221289 TACTCACATAGATAAAACTGAGG - Intergenic
1110065753 13:71103312-71103334 TTCCCACATGAATCAGGCTAAGG + Intergenic
1110946188 13:81421712-81421734 TTTTCTGATTAATAAGACTAAGG + Intergenic
1114759617 14:25298630-25298652 ATCTCACATAAAAAATACTTGGG - Intergenic
1114793558 14:25686202-25686224 TTCTTACATCAATTAGCCTATGG + Intergenic
1116599269 14:46898549-46898571 TTTTCAAATAAATAGGTCTAGGG + Intronic
1116670619 14:47837486-47837508 TTCTAAGATAAATAAACCTAAGG - Intergenic
1117120408 14:52562068-52562090 TTCTAACATAAATTAGATGATGG - Intronic
1118846132 14:69549069-69549091 GTCTCATATAAATAATAATAAGG + Intergenic
1119530988 14:75361285-75361307 TTCCCACTTCACTAAGACTAAGG + Intergenic
1120344367 14:83266236-83266258 TTGTCTCATAAACAAGACTGTGG + Intergenic
1125015887 15:34934413-34934435 TTCTCACATTAATGAGAGAAAGG - Intronic
1126452370 15:48822735-48822757 TTGTCCCATTAGTAAGACTATGG + Intergenic
1127642222 15:60926659-60926681 TTCTCTTATAAACGAGACTAAGG - Intronic
1130182510 15:81644928-81644950 TTATCACATAGATGAGACCATGG - Intergenic
1130630654 15:85565504-85565526 TTCTGCCATAAAGAGGACTATGG - Intronic
1130703859 15:86213186-86213208 TTCTTTCCTAAATAAAACTAAGG - Intronic
1131891219 15:96973432-96973454 TTCTCAGATAAAGAAGACACAGG - Intergenic
1133563339 16:6969739-6969761 GTCTCAAATAAATAAAAATAAGG + Intronic
1135760508 16:25134248-25134270 TTCTCACTTCAATAAGAGAAGGG - Intronic
1138874455 16:60932417-60932439 CTCTCAAATAATTAAGACCATGG - Intergenic
1140434125 16:74931135-74931157 TTCTAACTTAAATAAGCCTTGGG + Intronic
1140967091 16:79977450-79977472 TTCTCACATTCACAAGTCTATGG + Intergenic
1141030678 16:80585157-80585179 TTTTCATATTAATAATACTAAGG + Intergenic
1150820973 17:68434069-68434091 TTCTCACATAAATAAGACTATGG - Intronic
1153379551 18:4422101-4422123 TTTTCAAATAAAAAAGACTGCGG - Intronic
1153403004 18:4701833-4701855 TTCTAACATATATAATAATATGG - Intergenic
1154052400 18:10973530-10973552 TTTTCAGATAAATTAGACAATGG + Intronic
1155198724 18:23499355-23499377 ATCACACTTAAAAAAGACTATGG - Intergenic
1156448087 18:37251578-37251600 TTTTCTCATTAATGAGACTAAGG - Intronic
1168419721 19:56193542-56193564 TTTTTACATAATTATGACTAAGG - Intronic
1168616957 19:57845856-57845878 CTCCCACATCACTAAGACTAAGG - Exonic
926878632 2:17514974-17514996 TTCTATCATAAATAAAGCTATGG + Intronic
929105326 2:38359654-38359676 TTCCCACTTAAAGAACACTAAGG + Intronic
929386517 2:41414276-41414298 TGCTCCCATGAATAAGACTTGGG + Intergenic
929835687 2:45395514-45395536 TTCTCACACATATAAGCCTGAGG + Intronic
930896021 2:56447648-56447670 TCCTCATGTAAATAAGACTTTGG - Intergenic
931631596 2:64306611-64306633 TACTCTCATAATTAAAACTAAGG + Intergenic
933433881 2:82219787-82219809 TTCTCATCTAAATCATACTATGG + Intergenic
933445276 2:82371942-82371964 TGCTCACAGAAATAAAACAAAGG - Intergenic
935346261 2:102111242-102111264 TTCTCACCTGAATAACACCAGGG + Intronic
936236943 2:110750447-110750469 TTCTCAAATAAAAGAAACTAGGG - Intronic
938182813 2:129198764-129198786 TTCTGACATAAATAACTCTTAGG + Intergenic
941092793 2:161197753-161197775 CTCCCACATGAATAAGATTAAGG - Intronic
942779663 2:179626906-179626928 TTCTGGCATGAATAAGCCTAAGG - Intronic
942792630 2:179778175-179778197 TCCTCATATAAAGAAGACTATGG - Intronic
942885976 2:180924596-180924618 TTTTCAGATAAATTAGAATAAGG + Intergenic
942901130 2:181120417-181120439 TTTTCTCAGAAATAAGACAAAGG + Intergenic
943497695 2:188644225-188644247 TTCTCAGAAAAATAGAACTAGGG + Intergenic
944181298 2:196897890-196897912 TTCATCTATAAATAAGACTATGG - Intronic
946556414 2:220863129-220863151 TCCTCACATAAATAATTCTGGGG + Intergenic
946899028 2:224354818-224354840 TTCTGACATAAAGAAGCCCAGGG - Intergenic
947354159 2:229274895-229274917 TTCTCAAATAAAAATGACAAAGG + Intergenic
1170306640 20:14945579-14945601 TCCTTTAATAAATAAGACTAAGG - Intronic
1173247570 20:41347210-41347232 CTCTCACATCCATAAGAATAGGG - Intronic
1174848885 20:53972002-53972024 TTCTCACAGAAAGAAAAATAAGG - Intronic
1175191393 20:57214402-57214424 TTCTGTGATAAAGAAGACTATGG + Intronic
1175535199 20:59706091-59706113 TTCTCACATAATTAACTCAATGG + Intronic
1177114032 21:17063947-17063969 TTCTCACATAGACAGGACTGTGG + Intergenic
1177627253 21:23678680-23678702 TTATCACAAAAATAAGGCAAGGG - Intergenic
1181292433 22:21806622-21806644 ATCTTAAATAAGTAAGACTATGG + Intronic
1183859487 22:40659359-40659381 TTGTCACATAATTAAGTTTATGG + Intergenic
949225947 3:1696213-1696235 TTCTCTAATAATTAAGAATAAGG + Intergenic
955829280 3:62984023-62984045 TTATCACATAATTAAAATTAAGG - Intergenic
955835791 3:63053738-63053760 TTCTCACATGGAGAAGACCAAGG + Intergenic
955849222 3:63202169-63202191 TTTGCTCATAAATAAAACTAAGG - Intergenic
956599941 3:71009869-71009891 TTCCCAATTAACTAAGACTATGG + Intronic
956961245 3:74403765-74403787 TTTACACACAAATAAGAATAAGG - Intronic
957872165 3:86103249-86103271 TTATCACATGAACAAAACTAAGG - Intergenic
959197782 3:103208071-103208093 TTATGAAATAAATAACACTAAGG - Intergenic
960485861 3:118252092-118252114 TTCTCACATAAAAATAAGTATGG + Intergenic
960547449 3:118932536-118932558 TTCTAAGATAAATAACATTAGGG + Intronic
961832320 3:129629755-129629777 TTGTCACATAAATAAGCAAAGGG - Intergenic
962086979 3:132201456-132201478 ATCTCAGATAAATAAGCCAAAGG + Intronic
963326459 3:143868790-143868812 TTCTCACTTAAAGAAGAGTCCGG + Intergenic
963771755 3:149393380-149393402 TTGTTACCTAAATAAGACTAAGG + Intergenic
964121833 3:153193183-153193205 TTCTCACATAAATCTGAGTTAGG - Intergenic
964967317 3:162512247-162512269 ATCTCCCAGAAATAAGACTCAGG + Intergenic
965155914 3:165055133-165055155 TTTACAGATAAATAAGTCTATGG + Intronic
965419574 3:168440663-168440685 TTCTCACACAGTTAAGAGTAGGG - Intergenic
965420241 3:168448985-168449007 TTCTCACTTGAATAAAACTATGG + Intergenic
965854182 3:173067782-173067804 ATCCAACAGAAATAAGACTATGG + Intronic
967130961 3:186470341-186470363 TTGTCAGATAAATAAAATTAAGG + Intergenic
967492585 3:190110706-190110728 TTGACACATAATTAAGACTCTGG - Intronic
967696741 3:192541726-192541748 TTCCCAGACAAATAAAACTAAGG - Intronic
970047447 4:11871206-11871228 TTCTCACATAATTCAGATGACGG + Intergenic
970590059 4:17552021-17552043 TTCTATCATAAATAAAATTATGG - Intergenic
971719605 4:30228688-30228710 TTCTCACCTAAGTAAGAATCTGG - Intergenic
974223564 4:59008921-59008943 TTCTCAGAAAAATAACACAAGGG + Intergenic
976000218 4:80365481-80365503 TTCTCACATTAATGGGATTAAGG - Intronic
977183163 4:93903133-93903155 TACTCATATAAACAAAACTATGG + Intergenic
978280394 4:107005050-107005072 TTCTGACATATATAAGAGTGCGG + Intronic
979479001 4:121192766-121192788 TTTTAACATAAATGAGACAAAGG - Intronic
979483996 4:121249780-121249802 TTCTCACATAAAGAAGTCCTTGG + Intergenic
979768371 4:124490929-124490951 GTCTCACAAAAATAAGAAGAAGG + Intergenic
980783531 4:137522561-137522583 TTCTCACTGAAATAAGTCAATGG - Intronic
980958116 4:139448716-139448738 TTTTCACAAAAATAATATTATGG - Intergenic
980981743 4:139660035-139660057 TTTTCACAAAAATAATATTATGG - Intergenic
982851902 4:160328141-160328163 TCATCACATAAACATGACTAAGG - Intergenic
983021632 4:162684183-162684205 TTGTCACATAACCAAGACAAAGG + Intergenic
983662731 4:170146115-170146137 TTTGCACATAAATAAGAAGATGG + Intergenic
983675820 4:170290926-170290948 TTCTCAGATAACTAAATCTAAGG - Intergenic
984214966 4:176900493-176900515 TTATCACTTAAATAAAACTTTGG - Intergenic
984399601 4:179244424-179244446 TTCTCATAGAAATAACACTGTGG - Intergenic
984668626 4:182455910-182455932 TGCTCACAGAAATAAGAATCAGG - Intronic
986874403 5:12090131-12090153 TTGTAACAAAGATAAGACTATGG - Intergenic
987671464 5:21015311-21015333 TATTTACATAAATTAGACTAGGG + Intergenic
988960696 5:36368529-36368551 TCTTCAAATAAATAAGATTATGG - Intergenic
990894231 5:60680680-60680702 TTCTCAAATAAAGAAGGCAAGGG - Intronic
991025221 5:62021919-62021941 TTACCACATTAATAAGTCTAAGG + Intergenic
991106180 5:62844343-62844365 TTCTCACACCAAGAAGATTAAGG - Intergenic
992063784 5:73085048-73085070 TTCTCTCAAAAATAAGACACAGG + Intronic
992370808 5:76142009-76142031 TTCTCACATAAACAAGAGCAAGG + Intronic
992706443 5:79399307-79399329 TTCTCAGAGAAATAAGACTATGG - Intronic
993311785 5:86341492-86341514 TTATCAAATAAACAAGGCTAGGG - Intergenic
993433057 5:87855961-87855983 TTCTCACAAAGAAAAGACCAGGG + Intergenic
994614854 5:102091498-102091520 TTCTTACATAAATAATACATGGG - Intergenic
995402071 5:111754352-111754374 TTTAAACATAAATATGACTATGG - Intronic
999695476 5:154185233-154185255 TAAACACATAAATGAGACTATGG + Intronic
1000236180 5:159362661-159362683 CTCTCACATGAATATGACTTTGG + Intergenic
1000531488 5:162426926-162426948 TTCACACATCAGGAAGACTAAGG - Intergenic
1001127865 5:169036699-169036721 TTCTCATTTACATAAGACTTTGG - Intronic
1001150567 5:169224104-169224126 TTCTCACAGCAATGAGACTTTGG + Intronic
1003425976 6:5998706-5998728 TTCACACACAAATAAGAAAACGG - Exonic
1003677675 6:8221730-8221752 TTCTCTCATCAATAAGACTTTGG - Intergenic
1006205145 6:32334494-32334516 TTCTCAAAAAAATAAGAGGATGG - Intronic
1007782823 6:44264100-44264122 TGCTCATATAAATAGGAGTAGGG - Intronic
1008495638 6:52130903-52130925 CTCTCACATAAATAAGAAGGTGG - Intergenic
1009612738 6:65967230-65967252 TTCTAACATAGATAAGACACAGG + Intergenic
1010022489 6:71176818-71176840 TTCTGAGTTGAATAAGACTAAGG - Intergenic
1010069413 6:71725910-71725932 TTATGACATAAATTAGAATATGG + Intergenic
1010138197 6:72580668-72580690 TTCTGACATAAAAAACACTTTGG + Intergenic
1010351695 6:74882453-74882475 TTCTCAGAAAAACAAAACTAAGG + Intergenic
1010355239 6:74924860-74924882 TGCACACATAAATAAGAGGAAGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1012559285 6:100559509-100559531 TTTTCAAATAAATAATCCTAAGG + Intronic
1013071867 6:106736806-106736828 ATCTCCCATCACTAAGACTAAGG - Intergenic
1013481354 6:110555593-110555615 TTCTCACATAGATAAAAGAATGG + Intergenic
1013787848 6:113802127-113802149 TTCTAAAATAAAGGAGACTAAGG + Intergenic
1014378579 6:120710458-120710480 TTGTCACCGAAATAAGCCTATGG + Intergenic
1014395441 6:120922566-120922588 TTCTAAAATAATTTAGACTAAGG + Intergenic
1015293500 6:131564090-131564112 TTCTCAAATAAAAAGGACCAGGG - Intergenic
1015515613 6:134079970-134079992 ATCTCACATCAAGAAGATTAAGG - Intergenic
1016541265 6:145168438-145168460 TTCTCACAGAAATAATTCTAAGG + Intergenic
1017583420 6:155893413-155893435 TTCTCTCCTGCATAAGACTAAGG - Intergenic
1020724873 7:11799566-11799588 TTCTTAAATAAATATGCCTATGG + Intronic
1020917522 7:14214818-14214840 ATTTCAAATGAATAAGACTAAGG + Intronic
1021709007 7:23396563-23396585 TTCTCCCATACTTAACACTATGG - Intronic
1022654139 7:32303588-32303610 TTCTCAAATAAATTAGACCCAGG + Intergenic
1024007866 7:45240802-45240824 TTTTCCCAGAAATAAGACTTGGG - Intergenic
1024838213 7:53549769-53549791 TTTTCACATGAATAAGAGAAAGG - Intergenic
1025224192 7:57142490-57142512 GACTCTCATAAATAGGACTAGGG - Intergenic
1026134636 7:67648964-67648986 TGCACATATAAATAAGACTTAGG + Intergenic
1027802138 7:82767907-82767929 TTCTGAAATATATAAGACTATGG + Intronic
1028188010 7:87811887-87811909 TTTTCACAGAAATATGTCTAAGG - Intronic
1030236105 7:107264359-107264381 TTCTTACATACATAAGGGTATGG - Intronic
1031305826 7:120125755-120125777 TTCCCTCATAAATGAGATTAAGG + Intergenic
1031734224 7:125336641-125336663 TTCTTAAATAAAGAAGACTGAGG - Intergenic
1033007962 7:137587916-137587938 TTCTAAGATAAATAATACTTTGG + Intronic
1033075051 7:138241815-138241837 TTCTCAAATAAAGAAGAGTATGG - Intergenic
1033741649 7:144280605-144280627 TTCTCACAAACATGAGACCAGGG + Intergenic
1033752252 7:144369009-144369031 TTCTCACAAACATGAGACCAGGG - Intronic
1034579007 7:152026259-152026281 TTCACACATACACAAAACTAGGG + Intronic
1037282675 8:17260656-17260678 TTCCCACATAAATAAAAGCATGG - Intronic
1038096412 8:24316961-24316983 TTATAACATAAATAATACTTGGG + Intronic
1040048513 8:42988366-42988388 TTCTCACTAAAAAAATACTAGGG - Intronic
1040494266 8:47952060-47952082 TTCTCAGAAAATTAAAACTAAGG + Intronic
1040555234 8:48472258-48472280 TTCTCACAAAAATTAGCATATGG + Intergenic
1041644547 8:60238269-60238291 TACTAACATAAATAATACGACGG + Intronic
1043027791 8:75092726-75092748 TTGTCACATGAATAAAACTATGG - Intergenic
1043753572 8:83971811-83971833 TTCCCACATAAAAAAGAGAATGG + Intergenic
1044009399 8:86973916-86973938 TGCTCACATAGAAAAGAGTAAGG + Intronic
1044161256 8:88919016-88919038 TTCTCAAAAAAATATGTCTAAGG - Intergenic
1044553471 8:93537143-93537165 TTCTCAGAGAAATAATCCTAGGG + Intergenic
1046084903 8:109420855-109420877 TTCTTACAGAAATATGTCTATGG + Intronic
1048636586 8:136302392-136302414 TTCTAACATATATAAAATTAGGG + Intergenic
1049625944 8:143621020-143621042 TTCTCACATAAATAATCCTAAGG - Intergenic
1050091561 9:2019961-2019983 TTATCACATATGTAATACTAAGG + Intronic
1050340230 9:4630090-4630112 TTCTCAAAAAAACAAAACTATGG + Intronic
1051583596 9:18703987-18704009 TTTTCACATATATAAGCTTATGG - Intronic
1052597852 9:30584407-30584429 TTATCACATAAACAGAACTAAGG + Intergenic
1053113505 9:35482123-35482145 TTCTCCCATAAACAAGGCTTTGG + Intergenic
1053252437 9:36586035-36586057 TTAACACATAAATAAGTCAAAGG + Intronic
1054355660 9:64059428-64059450 TTCACACATAAGTAAAAATATGG - Intergenic
1055799423 9:80017411-80017433 TTCCCACTTAAATAATTCTAGGG - Intergenic
1055823421 9:80295711-80295733 TCGTCACATAAACAAAACTAAGG + Intergenic
1056879001 9:90370893-90370915 TTCTCAGATAAACAAAACTTAGG + Intergenic
1057223597 9:93272061-93272083 TTCTCAAATAAAGAAAACTAAGG + Intronic
1058263355 9:102865910-102865932 TGGACACATAAATGAGACTATGG + Intergenic
1058329643 9:103743558-103743580 TGTTCACATAAATTATACTAGGG - Intergenic
1186001022 X:5010630-5010652 CTCTGTTATAAATAAGACTAGGG + Intergenic
1186021974 X:5266614-5266636 TTCTACTATAAATAAGAATATGG - Intergenic
1186171049 X:6877330-6877352 TCCTAACATAAAAAAGAATATGG + Intergenic
1187492882 X:19768768-19768790 TTCACCCATAAATCAGACCATGG - Intronic
1189784090 X:44543616-44543638 TTCTCATAAAACAAAGACTATGG - Intergenic
1192043127 X:67644093-67644115 TTCTAAGCTAAATAAAACTAAGG - Intronic
1194589103 X:95774818-95774840 TTCCCACACAAATAACACAATGG + Intergenic
1194988398 X:100517519-100517541 TTATGACAGTAATAAGACTAGGG - Intergenic
1195061659 X:101201383-101201405 TTCTGAAATACATACGACTAAGG - Intergenic
1197187001 X:123598734-123598756 TTCTCAAGAAAATAAGCCTAAGG - Intergenic
1199267149 X:145841631-145841653 TTCTCACATATATTTGACTAAGG + Intergenic