ID: 1150822527

View in Genome Browser
Species Human (GRCh38)
Location 17:68446910-68446932
Sequence ACAGAGAGAAAACACTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 1, 2: 7, 3: 53, 4: 602}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150822521_1150822527 16 Left 1150822521 17:68446871-68446893 CCTCATGCTGGCTGCAGATAAGA 0: 1
1: 0
2: 2
3: 13
4: 191
Right 1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG 0: 1
1: 1
2: 7
3: 53
4: 602
1150822520_1150822527 17 Left 1150822520 17:68446870-68446892 CCCTCATGCTGGCTGCAGATAAG 0: 1
1: 0
2: 0
3: 14
4: 196
Right 1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG 0: 1
1: 1
2: 7
3: 53
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150822527 Original CRISPR ACAGAGAGAAAACACTGGGA GGG Intronic
900033286 1:386601-386623 ACAGAGAGAAAACCCCGGTGGGG - Intergenic
900054124 1:616490-616512 ACAGAGAGAAAACCCCGGTGGGG - Intergenic
900799709 1:4729601-4729623 ACAGAGGAAAGACAATGGGAAGG - Intronic
900908637 1:5578414-5578436 ACAGAGTGGAGACAGTGGGAGGG - Intergenic
901594941 1:10377460-10377482 ACAGAGAAAAAACAGTGGGCAGG - Exonic
901616415 1:10543473-10543495 ACAGAGAGAAAAGAGCAGGAAGG + Intronic
901681542 1:10915785-10915807 ACAGACAGACACCACTGCGATGG + Intergenic
901740792 1:11340371-11340393 GGAAAGAGGAAACACTGGGATGG + Intergenic
902469481 1:16638542-16638564 ACAGACAGAAAGCTCTGGAAGGG + Intergenic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
903363140 1:22789683-22789705 TCAGACAAAAAACTCTGGGAGGG - Intronic
904321479 1:29700319-29700341 GCAGAAAGATAACAATGGGAAGG + Intergenic
904362217 1:29983627-29983649 ACAGAGGGAAAGCACAGGGTTGG + Intergenic
904380795 1:30109386-30109408 CCAGAGGGATAACAATGGGAGGG - Intergenic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
904929502 1:34075193-34075215 ACAGAGAGGGGACACTGGAAAGG - Intronic
905099144 1:35503263-35503285 ACAGAGAGAAAGGATTGGGTAGG - Intronic
905344523 1:37302345-37302367 CAAGTGGGAAAACACTGGGAAGG + Intergenic
905486291 1:38299083-38299105 TCAGACAGAACCCACTGGGAAGG - Intergenic
905495128 1:38378810-38378832 ACAGAGTGAAACCACAGGTAAGG - Intergenic
905631187 1:39519442-39519464 CCAGAGAGAATCCACTGGGCAGG - Intronic
905666570 1:39766729-39766751 CCAGAGAGAATCCACTGGGCAGG + Intronic
906561628 1:46762405-46762427 ACAGAGAGAAAGCACAGGAGAGG - Intronic
906775070 1:48521750-48521772 ACAGAGAGAAAAAACAGGAAGGG - Intergenic
907380413 1:54082681-54082703 ACAGAGGCAAAAGAGTGGGAGGG + Intronic
907699590 1:56771868-56771890 ACGGAGAGAAAACAATTGGGTGG - Intronic
907740908 1:57164722-57164744 ACAGAGAGAAAGCACTGCTGGGG + Intronic
908002737 1:59696621-59696643 ACAGAAAGAAAACAATTGAAAGG - Intronic
909321710 1:74297129-74297151 AGAAAAAGAAAACACAGGGAAGG - Intronic
910961645 1:92769968-92769990 TGAGAGAGAAAACAATGTGAAGG + Intronic
911877056 1:103179755-103179777 ATAGAAAGAAAACACAAGGATGG + Intergenic
912034157 1:105290412-105290434 TTAGAGAGAAAACATTGGGTAGG - Intergenic
912177575 1:107179073-107179095 ACAAAGAGAAGACCCAGGGAGGG + Intronic
912251612 1:108017831-108017853 ACATAAAGAACACACTGGAAAGG + Intergenic
912958287 1:114171921-114171943 AGAGATGGAAAACTCTGGGAGGG + Intergenic
913069204 1:115284301-115284323 ACAGACACAGATCACTGGGAGGG + Intergenic
913159084 1:116129156-116129178 ACAGTGAGGAAGCACTGGAAAGG + Intronic
914463506 1:147906588-147906610 ACAGAGAGAATGCTTTGGGAAGG - Intergenic
914871093 1:151474635-151474657 ACACAGAGAAAAGACCAGGATGG + Intergenic
914984356 1:152443231-152443253 TTAGATACAAAACACTGGGAGGG + Intergenic
915029179 1:152861477-152861499 ACAGAAAGAAAACTCTGTGATGG - Intergenic
915076273 1:153310512-153310534 ACAAAGTGAAAGCACTCGGATGG + Intronic
916461273 1:165027456-165027478 ACATTGAGTAAGCACTGGGATGG - Intergenic
917142486 1:171850906-171850928 ACGAAGAGAAAAGACTGGTAAGG + Intronic
917143518 1:171862764-171862786 ACAGAGATAAATCACTTTGAGGG + Intronic
917173857 1:172209209-172209231 ACAGAGGAAAAACCCTGTGAGGG + Intronic
917245255 1:172994070-172994092 AAAGAGAAAAAAGAATGGGATGG - Intergenic
917506461 1:175631752-175631774 ACATAGAGAAAACCATGGAAAGG + Intronic
917669312 1:177257326-177257348 ACAGAGAGAGCACGCTGCGACGG + Exonic
917779624 1:178379388-178379410 ACAGAGAGAAAGGAAGGGGAGGG + Intronic
917929031 1:179811286-179811308 ACTCAGAGACAAAACTGGGAAGG + Intronic
918265056 1:182834264-182834286 ACAGAGATAAATCACTTAGAAGG - Intergenic
918282427 1:183020420-183020442 ACAGAGAGAAAAAGGAGGGATGG - Intergenic
918548620 1:185713682-185713704 ACAAAGAGAAAACGATGGGCTGG - Intergenic
918915504 1:190631881-190631903 ACAGACTGAAAATAATGGGATGG - Intergenic
919384634 1:196904921-196904943 AAATAGTGAAAACACAGGGAAGG - Intronic
920524280 1:206655308-206655330 ACAGAAAGAAAATCTTGGGAAGG + Intronic
920549900 1:206850160-206850182 ACAGAGTGAAAATAAAGGGATGG + Intergenic
920724013 1:208416602-208416624 AGAGAGAGAAAAGAATGGGCTGG - Intergenic
921625007 1:217370217-217370239 ACAGAGGGAAAACCATGTGAGGG + Intergenic
922233083 1:223702968-223702990 ACAGAGAGTAAGAACTGAGAAGG + Intronic
922983266 1:229846829-229846851 ACAGAGAGAATGCACTGTGCAGG - Intergenic
923620776 1:235577429-235577451 AAAAAAAGAAAACACTGAGATGG - Intronic
923976554 1:239270870-239270892 AAAGAAAGAAAACACTTGCAAGG - Intergenic
924630202 1:245730568-245730590 ACAGATAGAAAATAAAGGGATGG + Intergenic
1062761488 10:25603-25625 AAAGACAGAAAACAGTGGAAGGG + Intergenic
1062789107 10:290083-290105 ACAGAGAGGAGACGCTGGGGAGG + Intronic
1063096275 10:2911894-2911916 ACAGAGAGAAAAGGCTCTGAAGG - Intergenic
1063100786 10:2948068-2948090 AAAGAGAGAAAACACTTAGTGGG + Intergenic
1063437638 10:6047334-6047356 ACATAGAGGAAACACTAGAATGG + Intronic
1064221956 10:13448645-13448667 ACAAAGAGAAATCACTGAGAAGG + Intronic
1064472039 10:15645229-15645251 ACTGAGAGTAAACAAGGGGATGG - Intronic
1064580753 10:16790596-16790618 ACAGAGATGAAAAACAGGGAAGG + Intronic
1065066902 10:21977805-21977827 AAAGAGAGAAAACACTGATTAGG - Intronic
1065148423 10:22797030-22797052 ACAGAGAAAAAACATTGAAAAGG - Intergenic
1066372024 10:34825331-34825353 TCAGAGAGAGGACACTGGGGAGG - Intergenic
1067684555 10:48458745-48458767 ACTGAGCGTCAACACTGGGATGG + Intronic
1068676041 10:59770802-59770824 ACAGAGGCTAAACACTGGGAAGG - Intergenic
1068941393 10:62684571-62684593 AAAGGGAGTAAACACTGGGAAGG - Intergenic
1069156273 10:65034691-65034713 ACAGAGAGAAGACCCTGGACTGG - Intergenic
1070609689 10:77925208-77925230 CCAGAGAGAAAACTCTGGCTTGG - Intronic
1070647412 10:78211341-78211363 ACAGATAGAAAAGACTGGGAGGG - Intergenic
1071031331 10:81185857-81185879 ACAGAGAGAAAGCTATAGGATGG - Intergenic
1071060856 10:81570111-81570133 GCAGAGAGGAGACACTGGAATGG + Intergenic
1071342231 10:84659654-84659676 ACAGACAAAAATCCCTGGGATGG + Intergenic
1071670393 10:87603822-87603844 ACAGAAAAAAAACAGTGAGATGG - Intergenic
1071704733 10:87985465-87985487 ACAGAGAAAAAAAACTAGGCTGG + Intergenic
1072127527 10:92460431-92460453 ACAGAGAGAAGAAACTGAAAGGG + Intronic
1072600095 10:96917660-96917682 ACAGCGAGAAAATTATGGGAGGG + Intronic
1073673871 10:105623118-105623140 ACAGTGAGAACACACAGAGAGGG + Intergenic
1074456640 10:113601264-113601286 CCAGAGAGAAAGCTCTGGGTAGG - Intronic
1074581133 10:114720601-114720623 ACAGAGAGAGATCTTTGGGAAGG + Intergenic
1074957656 10:118408132-118408154 ACAGAGAGAAACCAAGGGAAAGG - Intergenic
1075619556 10:123915776-123915798 GCAGAGAGAAAACAATGACAGGG + Intronic
1075678285 10:124313062-124313084 ACAGAGAGAGATCACTAAGATGG + Intergenic
1075857449 10:125641985-125642007 ACAGAGATAAATGAGTGGGAAGG - Intronic
1076125592 10:127971473-127971495 ACCGAGTGAAAACACTGGGCAGG - Intronic
1077678212 11:4216036-4216058 AGAGAGAGGAAGCAGTGGGATGG - Intergenic
1078051548 11:7969245-7969267 ACAAAGAGAAAATAGGGGGAGGG + Intergenic
1078599130 11:12715256-12715278 CCAGAGACAAAACCCAGGGATGG + Intronic
1079242269 11:18729335-18729357 GCAGATGGAAAACACTGGCACGG - Intronic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1079839080 11:25371861-25371883 TCAGACAGAAAAAAGTGGGATGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1080576253 11:33602151-33602173 ACTGAGAGAATTCACTGGTAGGG + Intronic
1081486130 11:43530854-43530876 ACAGAGAGAGAACAGAGGGCTGG - Intergenic
1082642357 11:55678966-55678988 ACAGAGAGAAAACACTGGAAAGG + Intergenic
1082970356 11:59013698-59013720 ACACAGAGATAACACAGAGAAGG + Intronic
1083102920 11:60328772-60328794 AGAGAGAGAGAAAACTGGTAGGG + Intergenic
1084659544 11:70538780-70538802 ACACAGAGAAAGCACTGGGTGGG + Intronic
1085205577 11:74730386-74730408 AAAGAGAGAAAAGAATGGGAAGG + Intronic
1085782249 11:79420055-79420077 ACAAAGAGAACACAGTGGGTTGG - Intronic
1086771194 11:90769821-90769843 TCTGAGAAAAAACACTGGAAAGG + Intergenic
1087141077 11:94767035-94767057 ACAGAAGGAAAAGCCTGGGAGGG - Intronic
1088246167 11:107820279-107820301 AGAGAGAGAAAAGAAAGGGAGGG + Intronic
1088364096 11:109020665-109020687 ACAGAGGGAATCCACTGGTAAGG - Intergenic
1088466141 11:110140794-110140816 ACAGAGAGAAAATACGAGCATGG - Intronic
1088542158 11:110924335-110924357 ACAGTGAGAAAACAATGGGTCGG - Intergenic
1088901645 11:114122394-114122416 ACAGAGAGAAGACACTGGCTTGG + Intronic
1089013993 11:115152061-115152083 ACAGATGGAAAACAGTGTGAGGG + Intergenic
1089455701 11:118624559-118624581 AAAGAGAGAAAACACTTGGAAGG - Intronic
1089744790 11:120609169-120609191 AAAGAGAGAAAACTCTGAGAGGG - Intronic
1089783059 11:120887853-120887875 ATGGAGACAAAAGACTGGGAGGG + Intronic
1090007567 11:123016542-123016564 GCAGTGAGAAAACAGTGGGAGGG - Intergenic
1090168823 11:124580352-124580374 ACAGAGAGAAGACGCAGGAAAGG + Intergenic
1090643712 11:128750310-128750332 ACAGAGGGAAAGGAATGGGAAGG + Intronic
1090887662 11:130893439-130893461 AAAGAGAAAAAACACTGAGAGGG + Intronic
1091157380 11:133386197-133386219 AAAGAAAGAAAAAACTGGGTTGG - Intronic
1091175524 11:133554289-133554311 AGATAAAGGAAACACTGGGAAGG + Intergenic
1092685578 12:11041238-11041260 ACAGAGAGAAAATAAAGGGATGG + Intronic
1092691468 12:11115184-11115206 ACAGAAAGAAAACAACGGGATGG + Intronic
1092693523 12:11143616-11143638 ACAGATAGAAAATAAAGGGATGG + Intronic
1092959657 12:13583986-13584008 TCAGAGGGAAAATAATGGGAGGG + Intronic
1093668177 12:21839366-21839388 ACAGAAAGAAGACATTTGGAGGG + Intronic
1093821169 12:23619580-23619602 ACAAAGAGACAAACCTGGGAAGG + Intronic
1094098649 12:26736957-26736979 ACAGAGAGAAAACAAAGAGTTGG + Intronic
1094178183 12:27563529-27563551 ACAAAGAGAAAAGACTTGTAGGG + Intronic
1096657633 12:53101601-53101623 AAAGAGAGGGAACACTGGGCCGG + Intronic
1097001966 12:55884520-55884542 AAAGAGAGAAGACAATGTGAAGG + Intergenic
1097271617 12:57778606-57778628 AGAGAGAGAAAAGCTTGGGATGG - Intronic
1097339250 12:58418929-58418951 AAAGAGCGAGCACACTGGGATGG - Intergenic
1098086319 12:66848209-66848231 AGAGAGAGAAAAGAAAGGGAAGG - Intergenic
1098090008 12:66891573-66891595 ACAGGGGCTAAACACTGGGAGGG + Intergenic
1098239021 12:68447250-68447272 AGAGAGAGGAAACACTGAAATGG - Intergenic
1099105285 12:78488433-78488455 AAAAAGAGAAGACACTGGAAAGG + Intergenic
1100460904 12:94798384-94798406 ACAAGGAGAAAACAAGGGGAGGG + Intergenic
1100484323 12:95010016-95010038 ACAAATAGAAAACACAGGGCAGG - Intergenic
1100749600 12:97682624-97682646 ACAGAGATCAAAGATTGGGAAGG + Intergenic
1100776049 12:97975896-97975918 GCAGTGAGAAAACACTGGAGTGG - Intergenic
1100909121 12:99338250-99338272 AAGGAGAGAAAAGAATGGGAAGG - Intronic
1101405696 12:104426681-104426703 ACAGAGTGAAAATAAAGGGAAGG + Intergenic
1101830568 12:108253378-108253400 ACAGAGAGAGAAAAGGGGGAGGG - Intergenic
1102548593 12:113674499-113674521 AGAGAGAGAAAAGACAGAGAAGG - Intergenic
1102612764 12:114127280-114127302 ACTTAGAGAAAGCACAGGGATGG + Intergenic
1102842570 12:116141742-116141764 ACATGGAGAAGACACTGGGTTGG - Intronic
1103223218 12:119263990-119264012 AAAGAGAGAAAACTCAGTGATGG + Intergenic
1103354057 12:120306503-120306525 ACAGAGAAAGGAAACTGGGACGG + Intronic
1103857646 12:123984582-123984604 ACAGAAAGAAAACAGTTGAAAGG + Intronic
1104126955 12:125856758-125856780 ACAGAGAGAAAAGAATGAGGAGG + Intergenic
1104868273 12:131974627-131974649 ACAAAGAAAAAACACTCTGAAGG - Intronic
1105318062 13:19286861-19286883 AAAGAAAGAAAAACCTGGGAGGG + Intergenic
1106236721 13:27867914-27867936 ACTGAGAGAAATGACTGGGTAGG + Intergenic
1107030755 13:35851319-35851341 ACAGGGAAAGAACATTGGGAAGG - Intronic
1108853689 13:54767334-54767356 ACAAAAAGGAAACACTGGGCTGG - Intergenic
1108902014 13:55423201-55423223 TGAGACAAAAAACACTGGGAGGG - Intergenic
1109304881 13:60627323-60627345 ACAGAGTAACAACACTGGGGAGG - Intergenic
1109452758 13:62539778-62539800 ACAGAGAGAAAATACTGGAGAGG - Intergenic
1109694470 13:65935080-65935102 AGAGAGAGAAGAAAGTGGGAGGG + Intergenic
1109876984 13:68417568-68417590 ACAGAGTGTAAACACTAAGAAGG - Intergenic
1109948668 13:69472308-69472330 ACAGAGAGTACACAAAGGGAAGG - Intergenic
1110228562 13:73144609-73144631 AGAGAGAGAAAACAAAGGAATGG - Intergenic
1110272145 13:73603009-73603031 AGAGAGGGAAAATAATGGGAAGG + Intergenic
1111245147 13:85527876-85527898 AAAGGGAGAAAACACAGTGAGGG + Intergenic
1111489487 13:88953050-88953072 ACAGAGGGAACACAAAGGGAAGG + Intergenic
1111956222 13:94761434-94761456 ACAGGGAGAAGAGAATGGGATGG - Intergenic
1112118689 13:96385499-96385521 AAAGACAGAAGACTCTGGGATGG + Intronic
1112314961 13:98352463-98352485 ACAGAGAGAAATGACAGAGAAGG + Intronic
1112735058 13:102407096-102407118 ACAGAGAGAAAAGAAGGGGTTGG - Intergenic
1112784612 13:102938243-102938265 CAAGAGAGGAAACACAGGGATGG + Intergenic
1113297870 13:108981925-108981947 AGAGTCTGAAAACACTGGGAAGG - Intronic
1113365884 13:109675544-109675566 ACAGAGAGAAGGGAATGGGAGGG + Intergenic
1113452112 13:110418085-110418107 ACAGAGAGATATAACTGTGATGG - Intronic
1113585832 13:111463836-111463858 ACAGAAATGAAACTCTGGGAGGG - Intergenic
1114292659 14:21301262-21301284 ACAGGGCTAAGACACTGGGAAGG + Intronic
1115429121 14:33295852-33295874 ACAGTCAGAATACAATGGGATGG + Intronic
1116047846 14:39766003-39766025 ACAGATAGAATACAAAGGGAAGG - Intergenic
1116055155 14:39854738-39854760 AAAGAGAGAAAAAAATGGGAAGG - Intergenic
1116086984 14:40253523-40253545 AAGGAGAGGAAACAGTGGGAAGG - Intergenic
1117718402 14:58604066-58604088 ACAAAGAGGAAACACCAGGATGG - Intergenic
1117886756 14:60372050-60372072 ACAGAGAGGAAACATGGGGTTGG + Intergenic
1118650494 14:67887473-67887495 ACAAAGAGTAAACAATGAGAAGG - Intronic
1118697700 14:68400645-68400667 ACAGATAGAACACACTGTGGGGG + Intronic
1118848398 14:69565689-69565711 AGTGAGAGAATGCACTGGGAAGG + Intergenic
1118908914 14:70045264-70045286 ACTCAGAGAAAACAGTGAGATGG + Exonic
1119184656 14:72631434-72631456 TCTCAGAGAGAACACTGGGATGG + Intronic
1119976383 14:79028930-79028952 ACAGAGAGAAAGCATTGGGATGG + Intronic
1120760037 14:88276561-88276583 AGAGAAAGAGAACACAGGGAGGG - Intronic
1121080911 14:91107736-91107758 CTAGAGAGAAAACAATGGAATGG + Intronic
1121982464 14:98466908-98466930 ATAGAGAGAAATCATTGGCAGGG + Intergenic
1123801472 15:23825710-23825732 ACAGAGTTACACCACTGGGAGGG - Intergenic
1123817428 15:23994221-23994243 AAAGAAAGAAAACAGAGGGAGGG + Intergenic
1124219762 15:27840187-27840209 ACCAAGAGAAAGCACTAGGAAGG + Intronic
1124674544 15:31672797-31672819 ACTGGGAGAAAACTATGGGAAGG - Intronic
1125081683 15:35681340-35681362 ACACAGAGAAAACAATGGTGGGG - Intergenic
1125681098 15:41530677-41530699 AGAGAGAAAGAACAGTGGGATGG + Intronic
1126599099 15:50411048-50411070 ACTGAGTGAAAACACCAGGATGG + Intergenic
1127100908 15:55563859-55563881 GCAATGAGATAACACTGGGATGG + Intronic
1127125000 15:55803180-55803202 AGAGAGACTAAACACTGGGCTGG + Intergenic
1128928632 15:71682424-71682446 ACAGAGAGGGGACACTGGAAGGG - Intronic
1129099075 15:73241612-73241634 ATAGAAAGAAAGCACTGGGCTGG - Intronic
1130025819 15:80269601-80269623 ATAGAGATAAGAAACTGGGAAGG - Intergenic
1130246789 15:82258661-82258683 ACAGAGAAAACATACTGGCAGGG - Intronic
1130453882 15:84084675-84084697 AGAGAGAAAACACACTGGCAGGG + Intergenic
1131574485 15:93572758-93572780 TCAAAAAGAAAACACTGGGATGG - Intergenic
1131578834 15:93620104-93620126 ACATACAGCAACCACTGGGAAGG - Intergenic
1131995454 15:98128529-98128551 ACAGACAGAACACAATGGGGTGG - Intergenic
1133719333 16:8479869-8479891 AAAGAGAGAAAATAGTGGGCCGG + Intergenic
1133911011 16:10066677-10066699 ACATTTAGCAAACACTGGGAGGG - Intronic
1133911442 16:10069897-10069919 AAAGAGAGAAAGACCTGGGAAGG + Intronic
1134316977 16:13127563-13127585 ACAGAGAGAAGAGAAGGGGAGGG + Intronic
1135377689 16:21963445-21963467 ACAAAAACAAAACATTGGGAAGG - Intronic
1135476963 16:22785280-22785302 AGATAGAGAAAACCCTGGGAAGG + Intergenic
1135610203 16:23859688-23859710 AGAGAGAGAAGACACTTGGCAGG + Intronic
1135719930 16:24807640-24807662 ACAGAGAAAAAAGAGTGGGTGGG - Intronic
1136746819 16:32597953-32597975 ACACAGAGAAAAAGCTAGGATGG - Intergenic
1137500213 16:49005212-49005234 ACATGGAGAAAACTCTGGGAAGG - Intergenic
1137728216 16:50671040-50671062 ACAGAGAGAAAATACTTATATGG - Intronic
1138578217 16:57922392-57922414 AGAGAAAGAAACCACTGTGATGG - Intronic
1139126552 16:64085192-64085214 CCAGAGATAAAAGAGTGGGAAGG - Intergenic
1140694188 16:77515878-77515900 ACACATAGAACACAATGGGATGG + Intergenic
1140709894 16:77667669-77667691 ACAGAAAAATAACACTGGAATGG + Intergenic
1141020120 16:80487619-80487641 ACAGAGAGGACACACTGGTATGG + Intergenic
1142593893 17:1020377-1020399 ACAAAGAGAAAACAGTCGGCCGG - Intronic
1142642694 17:1293836-1293858 GCAGAGAGAGAACACAGAGAGGG + Intronic
1142649675 17:1340105-1340127 TAAGAGAGTAAACACTGGGAGGG + Intergenic
1143857447 17:9862707-9862729 AAAGTTAGCAAACACTGGGAAGG + Intronic
1144035222 17:11358954-11358976 AAAGAAAGAAAACTCTGGGCTGG - Intronic
1144142213 17:12360668-12360690 AAAGAGAGAAGACACTGGAGAGG + Intergenic
1146602911 17:34234188-34234210 AAGGAGATAAAACACAGGGAGGG + Intergenic
1146605342 17:34252811-34252833 TCAGACAGTAAACACAGGGAAGG - Intergenic
1147043868 17:37738727-37738749 ACAGAAAAAAAACTTTGGGATGG + Intronic
1147045559 17:37749243-37749265 ACAGAGAGCAAACCCTATGAGGG + Intergenic
1147264969 17:39229118-39229140 CCTCAGAGAAAGCACTGGGAAGG - Intergenic
1147302813 17:39543410-39543432 AGAGAAAGCAAACACTGGAAGGG - Intronic
1147318330 17:39631687-39631709 ACAGAGAGGAGAGGCTGGGAAGG + Intronic
1147479199 17:40742992-40743014 ACAGAGAGAAAAAATTAGGTAGG - Intergenic
1147803843 17:43115085-43115107 ACAGAAAGGAGAAACTGGGAAGG + Intronic
1147849646 17:43431982-43432004 CCAGAGAGAGAAGACTTGGAGGG - Intergenic
1148628884 17:49091585-49091607 CCATTGAGCAAACACTGGGATGG - Intergenic
1149180590 17:53931919-53931941 AAAGAGAGAAGAGAGTGGGAAGG - Intergenic
1149292207 17:55228150-55228172 ACAGAGAGTAGATACTCGGATGG - Intergenic
1149836507 17:59917814-59917836 AAGAAGAGAAAACAGTGGGAAGG - Intronic
1149871567 17:60186707-60186729 ACAGAGAGCAAAGAATGGGCGGG + Intronic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1151078617 17:71302958-71302980 ATATAGAAAAAAGACTGGGAAGG - Intergenic
1151176857 17:72295869-72295891 ACAGAAAGGAAACCCTGAGAGGG + Intergenic
1151235022 17:72713621-72713643 ACACATAAAAAAAACTGGGAGGG + Intronic
1151549395 17:74813313-74813335 TGACAGAGAAAACACTTGGAAGG - Intronic
1152494739 17:80662987-80663009 ACAGGGAGAAAAGGCTGGCAAGG - Intronic
1152529634 17:80910003-80910025 GCAGAGAAAAAACAGCGGGAAGG - Intronic
1152648627 17:81481813-81481835 ACAGGGAGAAGACAAGGGGAGGG - Intergenic
1152954395 18:25933-25955 AAAGACAGAAAACAGTGGAAGGG + Intergenic
1153367392 18:4272897-4272919 ACACAGAGAAAACCTTGTGAAGG + Intronic
1154931099 18:20997262-20997284 ACACAGAAAAAACAAGGGGATGG + Intronic
1155754385 18:29472277-29472299 TCAGAGAAGAAACACTAGGAAGG - Intergenic
1156518384 18:37700094-37700116 AAAGAGAGAAACAAATGGGAGGG + Intergenic
1156801770 18:41123755-41123777 AGAGAGAGGAAACTGTGGGAGGG + Intergenic
1157100896 18:44728685-44728707 AGGGAGAGAAAGCTCTGGGATGG + Intronic
1157791101 18:50531957-50531979 ACAGAGACAAGGCACTTGGAAGG - Intergenic
1158426630 18:57346325-57346347 CCTGAGAGATAACAGTGGGAGGG + Intergenic
1158747766 18:60220890-60220912 ATAGAGACCAAAGACTGGGAAGG - Intergenic
1159207057 18:65266408-65266430 AGAGAGAGAAAAAAAGGGGAAGG + Intergenic
1159271164 18:66152566-66152588 TCAGAGAAAAGACACTAGGAAGG + Intergenic
1159473605 18:68889009-68889031 ACAAAGAAAAACTACTGGGAGGG - Intronic
1159586033 18:70284467-70284489 ACATAGAGAGAACTCTGGGGAGG - Intergenic
1160133428 18:76250233-76250255 ACAAAGAGAAAACTTTGTGATGG - Intergenic
1161174457 19:2832506-2832528 GCAGATAGAAACCATTGGGATGG + Intronic
1161500333 19:4611086-4611108 ACAGAGAGAAAACAAGAGAAAGG + Intergenic
1161924216 19:7289244-7289266 ACAGTGAGAAAAGAGTGAGATGG + Intronic
1163099571 19:15086338-15086360 ACAGGGAGAGAACACAGGAAAGG + Intergenic
1163220145 19:15913207-15913229 ACAGAGAGAACGCACTGGGAGGG + Exonic
1164418693 19:28067763-28067785 ACAGTGTGGAAACACTGGAATGG + Intergenic
1164805338 19:31112024-31112046 ACAGAGAGCAGACAATGAGAAGG + Intergenic
1164939616 19:32242746-32242768 ATAGAGAGAGAGCACTGGGCTGG + Intergenic
1166062722 19:40336719-40336741 GCAGAGAGCAAGCACTGGGGCGG - Intronic
1166536850 19:43580100-43580122 GCAGGGAGAAAACACTGGTCGGG + Intronic
1167051559 19:47082079-47082101 ACAGAGAGAAAGCACAGAGAAGG + Intronic
1167533560 19:50034163-50034185 AAAGACAGAAGACCCTGGGATGG - Intronic
1167631297 19:50627856-50627878 ACAGAGAGAAGGCCCTGGCATGG + Intronic
925186522 2:1850247-1850269 AAAGAGAGAAAAGACAGGGAAGG - Intronic
926491572 2:13531516-13531538 AGAGAGAGAAAAAAAGGGGAGGG - Intergenic
926838509 2:17051675-17051697 CCTGAGAGAAAAGACTGGCAAGG + Intergenic
926888081 2:17616036-17616058 ACAGAAAGGAAAAACTGGGAAGG + Intronic
927127686 2:20027653-20027675 CGAGAGAGGCAACACTGGGATGG - Intergenic
927743151 2:25590541-25590563 GCAGAGAGAAGACCCTGGCAGGG + Intronic
928178482 2:29051147-29051169 ACAGAGAAAAACTACTGGGGAGG - Intronic
929243678 2:39678535-39678557 ACAGAGACAGAAAACAGGGAGGG + Intronic
929807600 2:45160704-45160726 ACAAAGAGAAGACACTCAGAGGG + Intergenic
929828827 2:45331263-45331285 ACACTGAGAAAACACTTAGATGG + Intergenic
930278400 2:49340548-49340570 ACAGAGAAAAAGTACTGAGAGGG + Intergenic
931990690 2:67787153-67787175 ACAGAAAAGAAACACTTGGAGGG + Intergenic
932092284 2:68817007-68817029 ACAGAGAGAAAACACCCAGAAGG - Intronic
932335377 2:70928139-70928161 ACAGAGAGACAACATTTGCAGGG + Intronic
932403043 2:71495472-71495494 ACAGTTTGAAAACACTGGGTTGG + Intronic
932409153 2:71535002-71535024 ACAGCTAGAAGACACAGGGAGGG - Exonic
933002621 2:76944606-76944628 ATAGAGAGAAATTACTGGGGAGG + Intronic
933540005 2:83627425-83627447 ACAGAGAAAAAAAACTGGCCTGG - Intergenic
933793268 2:85900532-85900554 ACAGCAGGAAAACACTGAGAGGG - Intergenic
934170496 2:89537450-89537472 ACAGACAGAAAAAACCTGGAAGG - Intergenic
934280798 2:91611770-91611792 ACAGACAGAAAAAACCTGGAAGG - Intergenic
934584374 2:95477299-95477321 ACATAGAGAAACCTCTGGGCCGG - Intergenic
934595078 2:95599416-95599438 ACATAGAGAAACCTCTGGGCCGG + Exonic
935156482 2:100487873-100487895 ACAGAGAGAAGGCCATGGGAGGG - Intergenic
935827178 2:106963502-106963524 ATAGTGAGGAAACACTGGGGAGG - Intergenic
936149035 2:110001455-110001477 AGAGAGAGAGAAAACAGGGAGGG + Intergenic
936195646 2:110369915-110369937 AGAGAGAGAGAAAACAGGGAGGG - Intergenic
936225535 2:110646339-110646361 ACAGAAAGAAAAGAAGGGGAGGG + Intronic
936470653 2:112796017-112796039 ACAGAAAGGAAACAGAGGGATGG + Intergenic
937304957 2:120865498-120865520 ACAGAAAGAAAACAAGGGAAGGG - Intronic
937464295 2:122116785-122116807 AGATAGATAACACACTGGGAAGG - Intergenic
937677283 2:124605963-124605985 AGAGAGAGAAAAATGTGGGAGGG - Intronic
937688279 2:124722896-124722918 ACAGAGAGAAGACAATAGGAAGG - Intronic
938095343 2:128457707-128457729 ACAGAGAGAAAACTCTCTGGAGG - Intergenic
938177647 2:129150407-129150429 ACAGACTGAAAACAAAGGGATGG - Intergenic
938816534 2:134910249-134910271 AAGGAGAGAAAACACTGAAAAGG - Intergenic
939695315 2:145316288-145316310 ACAGAGGTAAGACACTGGTAAGG - Intergenic
940069633 2:149671452-149671474 AGATAGAGAAAAAACAGGGAGGG - Intergenic
940145318 2:150539987-150540009 ACAAACAAAAAACACTGAGAGGG - Intergenic
940446330 2:153782650-153782672 ACAAAGAGAAGACAATGTGAAGG + Intergenic
941378840 2:164765980-164766002 AGAGACAGAAAACACTGTAATGG - Intronic
942856135 2:180551244-180551266 ATATAGAGAAAATACTGGCAGGG + Intergenic
943341914 2:186692408-186692430 GCATATTGAAAACACTGGGAGGG + Intergenic
943701666 2:190994386-190994408 ACAGGGAGGAAGGACTGGGAAGG + Intronic
944348125 2:198693162-198693184 CCTGAGAGAACACAGTGGGAGGG - Intergenic
944518768 2:200541498-200541520 ACACAGAAAAGACACTAGGATGG - Intronic
945528593 2:210921797-210921819 AGAGAGAGAAAGTATTGGGAAGG + Intergenic
945630010 2:212262757-212262779 ACAGAGAGAAAATAAAGAGAAGG - Intronic
945653187 2:212590468-212590490 ATGGAGAGAAGACACAGGGATGG + Intergenic
945653385 2:212592711-212592733 ATGGAGAGAAGACACAGGGATGG + Intergenic
946697621 2:222376059-222376081 ACAGACTGAAAACAAAGGGATGG + Intergenic
947567867 2:231206564-231206586 ACATAGAAAAAAGTCTGGGAGGG - Intronic
947832888 2:233154120-233154142 ACAAAGACAAAACACTTGGAGGG + Intronic
947849440 2:233273550-233273572 ACTGCCAGAAAACAGTGGGAAGG - Intronic
947872010 2:233444512-233444534 GCAGGGAGACACCACTGGGAGGG - Intronic
948092941 2:235310649-235310671 AAAGAGAGAAGACAATGGAATGG + Intergenic
1169072874 20:2744012-2744034 ACAGATAATAAAGACTGGGAAGG - Intronic
1169570788 20:6903012-6903034 AAAGAGAGAAAAAAAAGGGAGGG + Intergenic
1169719380 20:8657106-8657128 AGACAGAGAAAAAACAGGGAGGG + Intronic
1169747091 20:8953554-8953576 GCAGAGAGAAACCCCTGGGAAGG + Intronic
1170589790 20:17763167-17763189 ACAGAGATGAAAGACCGGGAAGG - Intergenic
1171368999 20:24648383-24648405 TCAGAGTGGACACACTGGGAAGG - Intronic
1171471816 20:25378209-25378231 GCAAAGAGAAAATACAGGGATGG - Intronic
1172330055 20:34069305-34069327 AATGAGAGAAAAGACTGGCAGGG + Intronic
1172419253 20:34800513-34800535 ACAGACTGAAAACAAAGGGATGG + Intronic
1172475765 20:35236344-35236366 AGAGAAAGAAAACTCCGGGAGGG - Intronic
1173539349 20:43839714-43839736 AAAGAGAGAAAATACAGAGATGG - Intergenic
1173687365 20:44933017-44933039 ACAGAGAGAGAAAAGTTGGATGG - Intronic
1174215607 20:48913953-48913975 AGAGAGAGAGAACAGTGAGAGGG + Intergenic
1174590131 20:51638564-51638586 AAAAAGAGAAAACAGAGGGATGG + Intronic
1174848829 20:53971264-53971286 GCAGAGAGAAAATAGTGGCATGG - Intronic
1174886420 20:54340057-54340079 AAAGAGGGAAAACACTAGCATGG + Intergenic
1176191678 20:63813931-63813953 TGAGAGAAAAAACAGTGGGAAGG + Intronic
1176367698 21:6043874-6043896 AGAGACAGAGAACACTGGGGAGG + Intergenic
1176552491 21:8232984-8233006 ACAGAGAGAACAGACAGGGAGGG - Intergenic
1177296647 21:19184745-19184767 TCAGAAAGAAAACACAGGTATGG + Intergenic
1178137874 21:29648743-29648765 AAAGAGAGAAAAACCAGGGAGGG + Intronic
1178461176 21:32803712-32803734 ACAGTAAGAAAACATTGGGGAGG - Intronic
1178606612 21:34042395-34042417 ACAGAGAGAAGACAGTGGTTTGG - Intergenic
1178607238 21:34049918-34049940 AAAGGGACAAGACACTGGGATGG + Intergenic
1179052785 21:37903081-37903103 AGAAAGAGAAAACACTGAGTAGG - Intronic
1179152079 21:38817782-38817804 CCAGAGAGAAAACACTGGGCCGG - Intronic
1179392611 21:41007888-41007910 ACAGAGGGATGACACTGTGAAGG - Intergenic
1179755821 21:43494668-43494690 AGAGACAGAGAACACTGGGGAGG - Intergenic
1180261121 21:46669578-46669600 AAAGAGAGGAAAGCCTGGGAAGG - Intergenic
1180583723 22:16866780-16866802 AGAGAGAGAAAGAACAGGGAGGG - Intergenic
1181614991 22:24048007-24048029 ACACACAGAAAAAAATGGGATGG - Intronic
1181657515 22:24315872-24315894 ACAGAGGGAAGACACAGAGAAGG - Intronic
1182362947 22:29758041-29758063 AGAGAAAGAAGACACTGAGATGG - Intronic
1183252750 22:36741997-36742019 ACAGAGTGAAACCCCTGAGATGG + Intergenic
1184823841 22:46933610-46933632 ACAGGGAGAGACCACTGGGGGGG + Intronic
1184906668 22:47492170-47492192 AGAGAGACAAAAGACAGGGAGGG - Intergenic
1185196477 22:49473570-49473592 CCAGGGAGAAAAGCCTGGGAGGG + Intronic
949094763 3:73193-73215 TCAGAGTGAAAACAATGGGGAGG - Intergenic
949492403 3:4601991-4602013 ACAGTGAGAAATCCCTAGGATGG + Intronic
949798509 3:7877810-7877832 AAAGAAAGAAAAAATTGGGAAGG + Intergenic
949876159 3:8627429-8627451 GCAGGGAGGAAACACAGGGACGG - Intronic
950031192 3:9854958-9854980 AAAGAGAGACAACACTGAAAAGG + Intronic
950420860 3:12898555-12898577 ACAGACAGAAAACCCCAGGAGGG - Exonic
950540580 3:13609918-13609940 CCAGAAAGAAATCCCTGGGAGGG - Intronic
950633651 3:14300165-14300187 ACAGACAGAAAACACCTGAAAGG - Intergenic
950731894 3:14967420-14967442 TCAGATAGTAAACACTGGAAAGG + Intronic
950860676 3:16145044-16145066 AGAGAGAGAAGAAACTGAGAGGG - Intergenic
950980776 3:17302296-17302318 ACAGAGGGAAGACAATGTGAAGG - Intronic
951305991 3:21063030-21063052 AGAGGGAGAATACACTGGAAAGG + Intergenic
951465715 3:22998572-22998594 CCTCAGAGAGAACACTGGGATGG - Intergenic
951703665 3:25522647-25522669 AAAGACAGAGAACACTGGAAAGG + Intronic
952132754 3:30384126-30384148 AAAGAGAGGAAAGAGTGGGAAGG - Intergenic
952934582 3:38386211-38386233 ACACAGAGACAACACAGGTAAGG - Intronic
953437375 3:42889123-42889145 AAAGGGAAAATACACTGGGATGG + Intronic
953532364 3:43750009-43750031 AGAAAGAGAGAACACTGGAAAGG - Intergenic
953688774 3:45099579-45099601 ACAGAGAAAAAATAGAGGGAAGG - Intronic
954299956 3:49695670-49695692 ACAGACAGAAAGCTCTGGAAGGG - Intronic
954446465 3:50549547-50549569 GCAGTGAGAAAAGCCTGGGAGGG + Intergenic
955040756 3:55315661-55315683 ACAGCTTGAAAATACTGGGATGG + Intergenic
955082279 3:55668991-55669013 AATGAAAGAAGACACTGGGAGGG - Intronic
955098038 3:55819629-55819651 ACAGAGAGAAAAGAAAGGAAAGG + Intronic
955746736 3:62148161-62148183 ACAGAGAAAACATACTGAGATGG + Intronic
956665632 3:71639516-71639538 GCAGAGAGGAAAAGCTGGGAAGG + Intergenic
957993608 3:87659518-87659540 ACAGAGAGAGAGCATTTGGAGGG - Intergenic
959646030 3:108702422-108702444 ACAGACTGAAAATATTGGGATGG - Intergenic
960333886 3:116392869-116392891 ACAGAGAGGAGACCCTGGGATGG - Intronic
960334361 3:116398093-116398115 ACAGAGAGTAAACTTTGGGATGG - Intronic
960342044 3:116486318-116486340 GCAGATGGAAAACACTGGCAAGG - Intronic
961096966 3:124165794-124165816 ACAGTGCGAAAGCACTTGGAAGG - Intronic
961153925 3:124662932-124662954 ACAGAGATAACACAGAGGGAAGG - Intronic
962286718 3:134092504-134092526 ACACAGAGATAACAGTGGGCAGG + Intronic
962581637 3:136803343-136803365 GAAGAGAGAAAACAGAGGGAAGG - Intergenic
962913014 3:139872318-139872340 AGAGAGAGAAAACAGAGAGACGG + Intergenic
963189924 3:142458323-142458345 TCAGAGATAAAATACTGGCATGG - Intronic
963423756 3:145096437-145096459 ATAGAGAGAAAAGAATGGGAGGG - Intergenic
963838246 3:150078950-150078972 CTAGAGAGAAAACACTGAGAAGG - Intergenic
964005059 3:151817155-151817177 AAAGAGGGAATACACTGTGAAGG - Intronic
964380866 3:156097855-156097877 AGAGAGAGAAAAAGCTAGGAGGG + Intronic
964818742 3:160746285-160746307 AGAGAGAGAGAACACTGGAGGGG + Intergenic
964871950 3:161322386-161322408 ACAGACTGAAAACAAAGGGATGG + Intergenic
965490855 3:169334006-169334028 AAAGAAAGAAAACACTCAGAAGG - Intronic
965774679 3:172216079-172216101 AAAGAGAGAAAATGCTGGGATGG + Intronic
966252583 3:177883252-177883274 ACAGATACAAATCACTTGGATGG + Intergenic
966651706 3:182308467-182308489 CTAGAGAGAAATCACTGGTAGGG - Intergenic
966666979 3:182482286-182482308 ACAGTGAGAAAACACTAGTAAGG + Intergenic
967507699 3:190271613-190271635 ATAGAAAGAAGACACTCGGACGG + Intergenic
968359258 3:198135609-198135631 AAAGACAGAAAACAGTGGAAGGG - Intergenic
968945631 4:3662115-3662137 ACAGACAGTAGACACCGGGAGGG + Intergenic
969994896 4:11301980-11302002 ACAGTCAGAAAATATTGGGATGG - Intergenic
970398254 4:15692953-15692975 ACACAGAGAAAATAATGTGATGG - Intronic
970771850 4:19622617-19622639 ACAGATACCAGACACTGGGAAGG + Intergenic
970969259 4:21962574-21962596 AAAGGAAGAAAACACTGTGATGG - Intergenic
971551541 4:27964257-27964279 ACAGACAGACAAGACAGGGAAGG - Intergenic
972790980 4:42370793-42370815 TCAGAGGGAAAACACCGGGGAGG + Intergenic
973176597 4:47213518-47213540 AGAGAGAGAAAAAAATGAGAGGG - Intronic
973763294 4:54140191-54140213 ACAGGGAGAGAAAAGTGGGAAGG + Intronic
974446402 4:61988762-61988784 AGGGAGAGAGCACACTGGGAAGG + Intronic
975552898 4:75631068-75631090 AGTGAGGGAAAACACTGAGATGG + Intergenic
975999728 4:80359516-80359538 ATAGAGAGAAAAGAATGGAAAGG - Intronic
977188910 4:93975848-93975870 ACAGGGAGAAAATACAGGAAAGG - Intergenic
977506824 4:97912612-97912634 ATAGAGAGAAAAGAATGAGAAGG + Intronic
977583758 4:98752333-98752355 GCAGAGAAAAAACTCTGGAAAGG - Intergenic
977595837 4:98878642-98878664 ACAGAGAGAAAACAGTAAGTTGG + Intronic
977907859 4:102499185-102499207 ACACAAAGGAAACACGGGGAAGG + Intergenic
978032669 4:103954511-103954533 ACAGACTGAAAATAATGGGATGG + Intergenic
978219700 4:106256001-106256023 GCAGAGAGAAGACCCTGGGGTGG + Intronic
978654424 4:111049295-111049317 AAGGAGAGAAAAGAGTGGGAAGG + Intergenic
979240283 4:118441684-118441706 ACAGAGAGAAAACCCCGGTGGGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979565012 4:122145397-122145419 AAAGGGAGAAAAAAGTGGGAAGG - Intergenic
980076269 4:128296916-128296938 ACAGAGAATGAACTCTGGGAAGG - Intergenic
981115868 4:140990531-140990553 ACAATGAGAAGACACAGGGAGGG - Intronic
981219797 4:142218115-142218137 GCAGAGAGAAATCAGTGTGATGG - Intronic
981611803 4:146600935-146600957 GCAGGGAGAACACACAGGGAAGG + Intergenic
981875857 4:149544952-149544974 ACAGGGGAAAAACACTGTGAAGG + Intergenic
981983584 4:150827104-150827126 ACAGAGGGAAAACAATTTGACGG + Intronic
982465467 4:155724652-155724674 ACCAAGAGAAGACACTGAGAAGG - Intronic
983057224 4:163112445-163112467 AGAGAGAGGAAACACATGGATGG + Intronic
983983475 4:174028117-174028139 ACATAGATAAAACATTTGGATGG + Intergenic
984837088 4:184032342-184032364 AGAGAGAGAAAAGACTGGAGGGG - Intergenic
985658383 5:1143650-1143672 ACACAGGGAGAACCCTGGGAAGG - Intergenic
987456104 5:18148956-18148978 ACTGAGACAAAATACTAGGATGG + Intergenic
987576669 5:19737136-19737158 ATAGAAAAAAAACACTGTGAAGG - Intronic
987631519 5:20478527-20478549 AAGGAGAGAGAAGACTGGGAAGG + Intronic
988015012 5:25544958-25544980 TCAGAGAGAAAAGCCTGGGTGGG - Intergenic
988508538 5:31845500-31845522 AGAGAGAGCTAACAGTGGGAGGG + Intronic
988934422 5:36067862-36067884 AGAGAGAGAAAAGTGTGGGAAGG + Intronic
989434444 5:41394593-41394615 ACAGACTGAAAATACAGGGATGG + Intronic
989483235 5:41957290-41957312 ACAAAGAGAAAAAACTGTAAAGG - Intergenic
989630296 5:43475334-43475356 ACAGAGAGGGTACACAGGGAGGG + Intronic
990094512 5:52095152-52095174 ACAGAGAAAAAACACTGAAATGG + Intergenic
990350576 5:54911633-54911655 ACAGGGAGCAAAAAATGGGAAGG - Intergenic
990422795 5:55653337-55653359 CCAGAGAGAAAATACTGGGCTGG + Intronic
991472783 5:66986532-66986554 ACAGAGAGAAAGTACTGGAAAGG - Intronic
992656649 5:78917020-78917042 ACAGAAACCAAACACTGTGATGG + Intronic
992748505 5:79841421-79841443 AGAGAGGGAAATAACTGGGAGGG - Intergenic
993048094 5:82891909-82891931 GAAGAGAGAAAACAGAGGGAAGG - Intergenic
993154086 5:84199583-84199605 ACAAAGAGAAAATAATGTGAGGG + Intronic
993178579 5:84519311-84519333 TCAGAGAGAAGGCACTGAGAAGG - Intergenic
994209878 5:97075290-97075312 ATCGAGAGAACACACTGGGCTGG + Intergenic
994562333 5:101391402-101391424 ACAGTGATAAAACCCAGGGAGGG + Intergenic
995476072 5:112549439-112549461 GCAGAAAGGAAACACTGAGAAGG - Intergenic
995749086 5:115435114-115435136 AAAAAGAAAAAACACTGGGTTGG + Intergenic
995782614 5:115794374-115794396 ACAGAGAGAAATAACTTAGAGGG + Intergenic
995782668 5:115794854-115794876 ACAGAGAGAAATAACTTAGAGGG - Intergenic
996848228 5:127924356-127924378 AGAACCAGAAAACACTGGGAGGG + Intergenic
996853812 5:127982207-127982229 ACAGAGTGGAAATACTGAGAGGG + Intergenic
999052977 5:148543885-148543907 GCAGAGAGAACACACTGGTCAGG + Intronic
999176142 5:149632973-149632995 TCATAGAGGAAACTCTGGGAAGG + Exonic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
999646159 5:153718909-153718931 GCTGAGAAATAACACTGGGATGG - Intronic
999652160 5:153778094-153778116 AGAGATAGAAAAAAATGGGAGGG + Intronic
1000040769 5:157483575-157483597 CCAAAGAGATTACACTGGGATGG + Intronic
1000682505 5:164203427-164203449 ATATGGAAAAAACACTGGGAAGG + Intergenic
1001684598 5:173584030-173584052 ACAGAGGGAAAAGAATAGGAAGG - Intergenic
1001838465 5:174852815-174852837 ACAAAGAGAGGAAACTGGGAGGG + Intergenic
1002363828 5:178694951-178694973 AGAGAGAGAAGACACATGGAGGG + Intergenic
1002451870 5:179323361-179323383 ACAGAGAGAATACTTTGGGGAGG + Intronic
1002740534 5:181432267-181432289 ACAGAGAGAAAACCCCGGTGGGG + Intergenic
1003462740 6:6346619-6346641 ACAGAAAGATGACACGGGGAAGG - Intergenic
1003677560 6:8220152-8220174 ACAGAGACAAAAGATTGAGAAGG + Intergenic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1004335156 6:14757738-14757760 ACAGAGGGAAGACAATGTGAAGG - Intergenic
1004471984 6:15937715-15937737 ACAGAGAGAAGACACACAGAAGG + Intergenic
1006591899 6:35164355-35164377 AGAGAGAGAACAGACTGGGCAGG - Intergenic
1006695015 6:35923503-35923525 AGAGAGAGAAAACACTGAGAGGG + Intergenic
1006812357 6:36828085-36828107 AAGGACAGAAAACACTGGAAGGG + Intronic
1008443184 6:51556454-51556476 TAAGAGACAAAAAACTGGGAAGG + Intergenic
1008707356 6:54179261-54179283 ACAGAGTGAAAATAAAGGGATGG - Intronic
1011208804 6:84932017-84932039 TCACAGAGAAAACACTGGAATGG - Intergenic
1011418699 6:87150431-87150453 ACAGAGGGTAAACACTTGGTGGG + Intergenic
1011757779 6:90522210-90522232 AGAAAAAGAAAACAATGGGACGG + Intronic
1012499042 6:99868610-99868632 ACCGTGAGAGAACACTGGGCTGG + Intergenic
1012605327 6:101151445-101151467 AAAGGGAGAAGAGACTGGGAGGG + Intergenic
1012763916 6:103339840-103339862 ACAGAGAGAAAATAATGTGATGG - Intergenic
1013770300 6:113620925-113620947 ACAGAGAGACAAGACAGGGTTGG - Intergenic
1013840413 6:114385862-114385884 ACAGAGATAAAAGACTGTGTTGG + Intergenic
1013861259 6:114638089-114638111 ACATAGAAAAAGGACTGGGATGG - Intergenic
1014692483 6:124578494-124578516 AAAGAGAGGAAAGAGTGGGAAGG + Intronic
1015123044 6:129722125-129722147 ACAAAGAGAAAACACAGTGGTGG + Intergenic
1015153240 6:130062302-130062324 ACACAGAGAAAACATCTGGAAGG - Intronic
1015871764 6:137782616-137782638 AAAGAGAGGAAACTGTGGGAAGG + Intergenic
1017001845 6:150002719-150002741 ACAAAGACAAAACACAAGGATGG + Intergenic
1017305668 6:152915473-152915495 ACAGAGAGCAGGCACTGGAATGG + Intergenic
1018205783 6:161436124-161436146 ACAGAGAGCAGAGGCTGGGATGG + Intronic
1018230195 6:161667872-161667894 AGAGTGAGAAAAACCTGGGAGGG + Intronic
1018496319 6:164348967-164348989 ATGGAGAGGAAACACTAGGAGGG - Intergenic
1018681239 6:166267532-166267554 ACAGACAGAAAACGGTGGAAAGG + Intergenic
1018754652 6:166838658-166838680 ACTGACACAAAAGACTGGGAAGG - Intronic
1019177103 6:170165524-170165546 GCAGGGAGAGAGCACTGGGAGGG - Intergenic
1020141639 7:5615041-5615063 ACAGGGAGAATCCACAGGGATGG - Intergenic
1020699019 7:11454003-11454025 ACAGAGAGAAAAGACAGTGGAGG + Intronic
1020827470 7:13048126-13048148 ACAGAGTGACAACAATTGGAAGG + Intergenic
1021089451 7:16465815-16465837 TCAGAGTGAAAACACAGAGAAGG + Exonic
1021391403 7:20097404-20097426 ACATAGAGATATCACTGGCAAGG + Intergenic
1021911210 7:25387289-25387311 ACAGAGAGAACACCCTGGCAAGG - Intergenic
1022366729 7:29728280-29728302 ATAGACAGAAAACAAAGGGATGG - Intergenic
1022627732 7:32055271-32055293 ACAGAGGGAAAGCAATGAGAAGG + Intronic
1022628784 7:32065700-32065722 ATAGAAAGAAAACACAGAGAGGG + Intronic
1023093700 7:36639815-36639837 CCAGGGAGAAAGCTCTGGGAGGG - Intronic
1023266047 7:38406927-38406949 ACAGAGAGAAACCAGTAGCAAGG - Intronic
1023682286 7:42699706-42699728 ACAGAGAAAAAGCACGTGGAAGG + Intergenic
1023975569 7:45027324-45027346 GCAGACAGAAAGCACTGTGAGGG - Intronic
1024045460 7:45582635-45582657 ACAGAGGAGAAACACTGGGAGGG - Intronic
1026944111 7:74305448-74305470 ACAGAGAGGGGACACTGGGAGGG - Intronic
1028545146 7:91990810-91990832 ACAGAAAGTAAAAACAGGGATGG - Intronic
1030374366 7:108738143-108738165 CCAGAGTTAAAACACTGGAAAGG - Intergenic
1030752764 7:113250832-113250854 ACAGACCGAAAACAAAGGGATGG + Intergenic
1030908170 7:115212367-115212389 TGAGTGAGAAAAGACTGGGATGG + Intergenic
1031738545 7:125398345-125398367 ACACTTAGAAAATACTGGGATGG + Intergenic
1031979174 7:128113283-128113305 ACAGAGAGTAGACCCTGGGTGGG + Intergenic
1032122365 7:129166374-129166396 AGATAGAGAAAACACAGGGGAGG - Intronic
1032293623 7:130614171-130614193 ACTGGGAAAAAGCACTGGGAAGG + Intronic
1032444413 7:131969477-131969499 ACAAAGAGGAAACACTGAGGTGG + Intergenic
1032738682 7:134716595-134716617 ACAGAGTGAAAACAATGTCAGGG + Intergenic
1032921170 7:136550065-136550087 ACAGAGAGAAATCAATAAGAAGG + Intergenic
1033259144 7:139827153-139827175 AGTGAGAGAAAAGACAGGGAGGG - Intronic
1033591367 7:142811483-142811505 AAAAAGAGAAATCACTTGGATGG - Intergenic
1034080129 7:148268953-148268975 ACAGAGAGGAAAGATTGGGCAGG + Intronic
1034844877 7:154435233-154435255 ACAGAGAGAGAACAAGGAGAAGG + Intronic
1034980040 7:155469851-155469873 ACCGTGAGAAAAAAGTGGGACGG + Intergenic
1035181561 7:157093084-157093106 ACAGAGAGAGAAGCCTGGCATGG + Intergenic
1035502480 8:100334-100356 ACAGAGAGAAAACCCCGGTGGGG - Intergenic
1036125673 8:6059566-6059588 CCAAATAGAAAATACTGGGAAGG + Intergenic
1036490801 8:9223786-9223808 GCAGAGAGAGAACACTGAAATGG + Intergenic
1036537630 8:9665965-9665987 ACAGAGAGAAAAAAAGAGGAGGG - Intronic
1037793849 8:21974437-21974459 ACAGAGGGAAAACAAAAGGATGG - Intronic
1038386797 8:27156120-27156142 AGAGAGAGAAGACACTCAGAGGG + Intergenic
1039299440 8:36193799-36193821 CCAGAGAGAGAATGCTGGGAGGG - Intergenic
1039478300 8:37853185-37853207 CCAGAGAGAAATGGCTGGGAGGG - Intergenic
1040745950 8:50642722-50642744 GAAGACAGAAAATACTGGGAAGG - Intronic
1041971726 8:63750865-63750887 AAAGAGAAAAAGCACAGGGAGGG - Intergenic
1042405993 8:68406149-68406171 ACAGAGAGGAAACAAATGGAAGG + Intronic
1042723307 8:71846556-71846578 ACAGAGAAAGAAGACAGGGAGGG - Intronic
1042898679 8:73698428-73698450 ACAGACAGAAAAGAGAGGGATGG + Intronic
1043231549 8:77808535-77808557 TCTGAGAGAAAACATTGGAATGG + Intergenic
1043385866 8:79747414-79747436 ACAGAGAGAAGTCACTGGCCTGG + Intergenic
1043683850 8:83064705-83064727 ACAGAGACTGAACACTGGGCAGG - Intergenic
1043939276 8:86178533-86178555 ACAGAGAGTAAACAGAGGAAAGG + Intergenic
1044079264 8:87863814-87863836 ACATAGAGTCAACACTGGAATGG - Intergenic
1044306570 8:90646271-90646293 GCGGAGGGAAACCACTGGGAGGG + Intronic
1045818913 8:106311908-106311930 ACAGAGAGAAGAGGCAGGGAGGG - Intronic
1047307599 8:123665605-123665627 ACAGAGAGAAACAAACGGGAGGG - Intergenic
1047701667 8:127455245-127455267 CCAGAGGCAAGACACTGGGAGGG + Intergenic
1047809309 8:128391045-128391067 AGAGAGAGAAAAGTCTTGGAAGG - Intergenic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1048723208 8:137351537-137351559 ACAGACTGAAAATAATGGGATGG - Intergenic
1048788726 8:138080277-138080299 ACACAGAGCAAACAGAGGGAGGG - Intergenic
1049795969 8:144497401-144497423 CCAGAAGGACAACACTGGGAGGG - Exonic
1049808762 8:144553799-144553821 ACTGACAGCAAACACTGGGCTGG + Intronic
1050625918 9:7503516-7503538 AGAGAGAGAAAGCACTGGAAGGG + Intergenic
1051243017 9:15080279-15080301 AATGAGAGAAAATAGTGGGAGGG - Intergenic
1051480908 9:17559257-17559279 AAAGAAAGAAAACATTGGAAAGG + Intergenic
1053151728 9:35748133-35748155 GAAAAGACAAAACACTGGGAGGG + Intronic
1053169324 9:35867679-35867701 GCAGGGAGAAAGCCCTGGGAGGG + Intergenic
1054807936 9:69411336-69411358 ATTGAGAGACAACACTAGGATGG - Intergenic
1055160078 9:73115712-73115734 AGAGAGGGAAAAGACTGGGCTGG - Intergenic
1055406120 9:75975180-75975202 ACAGTGGGAAAACTCAGGGAGGG - Intronic
1055882574 9:81019285-81019307 GGAGAGAGATAACACTGGGTCGG + Intergenic
1057043738 9:91867430-91867452 ACAGAGAGAAAAAACAGCAATGG - Intronic
1057438768 9:95066223-95066245 ACAGAAAGAAAACCCTAAGAAGG - Intronic
1058148712 9:101440850-101440872 ACAAAGAGAAAACACTGACAAGG - Intergenic
1059805632 9:117797396-117797418 AAATGGAGAAAACACTGAGAAGG - Intergenic
1059837350 9:118170708-118170730 ACAGGGAGAAAATCCTGGGAAGG - Intergenic
1060212569 9:121719535-121719557 AGAGTGAGAAATCATTGGGAAGG + Intronic
1060569423 9:124624545-124624567 GCAGAGACAGAACGCTGGGACGG + Intronic
1061417584 9:130455512-130455534 ACAGAGAGATAAAAGAGGGAAGG - Intronic
1061472954 9:130841910-130841932 ACAGAGAGAAATAGGTGGGAAGG + Intronic
1061529555 9:131199467-131199489 GGAGACAGAAAACACTGGCAGGG - Intronic
1062570888 9:137184835-137184857 ACACAGAGGAGACACGGGGAAGG + Intronic
1062743945 9:138199328-138199350 AAAGACAGAAAACAGTGGAAGGG - Intergenic
1203605843 Un_KI270748v1:57075-57097 ACAGAGAGAAAACCCCGGTGGGG + Intergenic
1186893342 X:13981860-13981882 AAAGAGAGATAATCCTGGGAGGG + Intergenic
1186984226 X:14994245-14994267 ATAGAGGGAAAGCACTGGGCTGG + Intergenic
1187174988 X:16888252-16888274 AGAGAGAGAAAACGAAGGGAAGG - Intergenic
1187260351 X:17679756-17679778 AAAGAGACAGAACACAGGGAAGG + Intronic
1187500376 X:19833719-19833741 AAAGAGAGAAGACCCTGGGAAGG - Intronic
1187528033 X:20071633-20071655 ACAGAGAGTAGCCACAGGGAGGG - Intronic
1188161603 X:26811743-26811765 ACAGACTGAAAACAAAGGGAAGG - Intergenic
1188187834 X:27137430-27137452 ACAGAGAGAAAACAATGAAAAGG - Intergenic
1188518636 X:31013667-31013689 ACAGAGAGAATACAGAGGAAGGG + Intergenic
1188566294 X:31530361-31530383 GCAGAGAGAAGACACTGGAAGGG + Intronic
1188623071 X:32250578-32250600 CCAGAGTGAAAACACTGGGGAGG - Intronic
1188743013 X:33809436-33809458 GAGGAGAGAAAAGACTGGGATGG - Intergenic
1189091890 X:38092332-38092354 AAAGAGAGAAGACAGTAGGATGG + Intronic
1189158538 X:38785715-38785737 ACAGAGAGAAACAAAGGGGAAGG + Intergenic
1189640834 X:43068530-43068552 AAGGAGAGGAAAGACTGGGAAGG + Intergenic
1190153685 X:47969546-47969568 ACAGAGAGAAACAACTGATAGGG - Intronic
1190239195 X:48644252-48644274 ATAGAAACAAAACACTAGGATGG + Intergenic
1190332365 X:49243553-49243575 ACAGAGGGGAAACAATGGAAGGG - Intronic
1191641784 X:63434341-63434363 ACAGAGAGGAAAGAGGGGGAAGG + Intergenic
1192065499 X:67880466-67880488 AAGGAGAGGAAACAGTGGGAAGG + Intergenic
1192757651 X:74063453-74063475 ACAGAGTGAAGACAGTGTGAAGG - Intergenic
1192776920 X:74254903-74254925 ACAGAGAGAAAATAGTTGGGGGG + Intergenic
1192831213 X:74752463-74752485 ACAGAGAGAAAGAAAAGGGAAGG - Intronic
1193726239 X:85042423-85042445 ACAGACAGATAACAATGAGATGG + Intronic
1193755844 X:85408138-85408160 AAGGAGAGAAAAGAATGGGAAGG - Intergenic
1193939114 X:87658248-87658270 ACTGAGAGAAGACAGTGGTATGG - Intronic
1195028086 X:100898506-100898528 ACAGACTGAAAAGAATGGGAAGG + Intergenic
1195786870 X:108534564-108534586 ACAGAGAACAGAGACTGGGAAGG + Intronic
1196248478 X:113429043-113429065 AAGGAGAGAGAAGACTGGGAAGG + Intergenic
1196428977 X:115602019-115602041 TCAGAGAGACATCACTGGTAAGG - Intronic
1197196462 X:123707176-123707198 ACATACAGAAAAAACTGGAAAGG - Intronic
1197356089 X:125438698-125438720 ACAGAGGGAAAACAGCAGGAGGG - Intergenic
1197378752 X:125713278-125713300 TCAGAGGGAAGACACTGAGAGGG + Intergenic
1197866970 X:131029327-131029349 AGAGAAAGAAAACAAAGGGAAGG - Intergenic
1197953207 X:131919469-131919491 ACAGGGAGGAAAGAGTGGGAAGG + Intergenic
1198427031 X:136530748-136530770 ATAGATACCAAACACTGGGAAGG - Intergenic
1198543625 X:137668608-137668630 AGAGAGATAAAACACATGGAAGG + Intergenic
1198794242 X:140378788-140378810 ATAGAGAAAAAACACTGGCCTGG - Intergenic
1199092349 X:143706161-143706183 GCAGAGAGAAAACCCTGGAGAGG - Intergenic
1199600847 X:149540320-149540342 GGAGAAAGAAATCACTGGGAGGG - Intergenic
1199620799 X:149698807-149698829 AAACAGTGAAAACACAGGGAGGG - Intronic
1199649798 X:149939760-149939782 GCCGAGAGAAACCACTGGGGAGG + Intergenic
1199683634 X:150244764-150244786 ACAGACATAAAGTACTGGGAAGG + Intergenic
1199871206 X:151900454-151900476 ACAGAGAGGAGAAGCTGGGAGGG + Intergenic
1200699411 Y:6389437-6389459 ACAGGGAGTAAACACTGGCTTGG - Intergenic
1201034700 Y:9775261-9775283 ACAGGGAGTAAACACTGGCTTGG + Intergenic
1201552746 Y:15235816-15235838 AGAGAGAGATATCACTGGGCAGG + Intergenic