ID: 1150823730

View in Genome Browser
Species Human (GRCh38)
Location 17:68457112-68457134
Sequence CCTCCCAGAGCGACAAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 113}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150823730_1150823736 -10 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823736 17:68457125-68457147 CTCTGGGAGGACACTGGGAGTGG 0: 1
1: 0
2: 5
3: 59
4: 749
1150823730_1150823743 1 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823743 17:68457136-68457158 CACTGGGAGTGGGGTGGGGTGGG 0: 1
1: 2
2: 30
3: 219
4: 1399
1150823730_1150823750 27 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823750 17:68457162-68457184 TGCGGCAAACCCCACTGAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1150823730_1150823744 2 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823744 17:68457137-68457159 ACTGGGAGTGGGGTGGGGTGGGG 0: 2
1: 4
2: 70
3: 389
4: 2196
1150823730_1150823737 -9 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823737 17:68457126-68457148 TCTGGGAGGACACTGGGAGTGGG 0: 1
1: 1
2: 3
3: 34
4: 388
1150823730_1150823746 4 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823746 17:68457139-68457161 TGGGAGTGGGGTGGGGTGGGGGG 0: 1
1: 21
2: 130
3: 2117
4: 12525
1150823730_1150823742 0 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823742 17:68457135-68457157 ACACTGGGAGTGGGGTGGGGTGG 0: 1
1: 1
2: 25
3: 169
4: 1285
1150823730_1150823747 9 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823747 17:68457144-68457166 GTGGGGTGGGGTGGGGGGTGCGG 0: 4
1: 45
2: 470
3: 10262
4: 27099
1150823730_1150823749 26 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823749 17:68457161-68457183 GTGCGGCAAACCCCACTGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1150823730_1150823738 -8 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823738 17:68457127-68457149 CTGGGAGGACACTGGGAGTGGGG 0: 1
1: 1
2: 5
3: 44
4: 503
1150823730_1150823741 -3 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823741 17:68457132-68457154 AGGACACTGGGAGTGGGGTGGGG 0: 1
1: 0
2: 6
3: 127
4: 891
1150823730_1150823745 3 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823745 17:68457138-68457160 CTGGGAGTGGGGTGGGGTGGGGG 0: 1
1: 8
2: 87
3: 621
4: 5892
1150823730_1150823748 25 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823730_1150823739 -5 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823739 17:68457130-68457152 GGAGGACACTGGGAGTGGGGTGG 0: 1
1: 0
2: 9
3: 93
4: 797
1150823730_1150823740 -4 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823740 17:68457131-68457153 GAGGACACTGGGAGTGGGGTGGG 0: 1
1: 0
2: 3
3: 80
4: 646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150823730 Original CRISPR CCTCCCAGAGCGACAAGGTT GGG (reversed) Intronic