ID: 1150823733

View in Genome Browser
Species Human (GRCh38)
Location 17:68457117-68457139
Sequence AGTGTCCTCCCAGAGCGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150823733_1150823744 -3 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823744 17:68457137-68457159 ACTGGGAGTGGGGTGGGGTGGGG 0: 2
1: 4
2: 70
3: 389
4: 2196
1150823733_1150823740 -9 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823740 17:68457131-68457153 GAGGACACTGGGAGTGGGGTGGG 0: 1
1: 0
2: 3
3: 80
4: 646
1150823733_1150823743 -4 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823743 17:68457136-68457158 CACTGGGAGTGGGGTGGGGTGGG 0: 1
1: 2
2: 30
3: 219
4: 1399
1150823733_1150823749 21 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823749 17:68457161-68457183 GTGCGGCAAACCCCACTGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1150823733_1150823747 4 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823747 17:68457144-68457166 GTGGGGTGGGGTGGGGGGTGCGG 0: 4
1: 45
2: 470
3: 10262
4: 27099
1150823733_1150823745 -2 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823745 17:68457138-68457160 CTGGGAGTGGGGTGGGGTGGGGG 0: 1
1: 8
2: 87
3: 621
4: 5892
1150823733_1150823741 -8 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823741 17:68457132-68457154 AGGACACTGGGAGTGGGGTGGGG 0: 1
1: 0
2: 6
3: 127
4: 891
1150823733_1150823751 27 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823751 17:68457167-68457189 CAAACCCCACTGAAGGGGTACGG 0: 1
1: 0
2: 1
3: 17
4: 169
1150823733_1150823746 -1 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823746 17:68457139-68457161 TGGGAGTGGGGTGGGGTGGGGGG 0: 1
1: 21
2: 130
3: 2117
4: 12525
1150823733_1150823739 -10 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823739 17:68457130-68457152 GGAGGACACTGGGAGTGGGGTGG 0: 1
1: 0
2: 9
3: 93
4: 797
1150823733_1150823742 -5 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823742 17:68457135-68457157 ACACTGGGAGTGGGGTGGGGTGG 0: 1
1: 1
2: 25
3: 169
4: 1285
1150823733_1150823748 20 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823733_1150823750 22 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823750 17:68457162-68457184 TGCGGCAAACCCCACTGAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 73
1150823733_1150823752 28 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823752 17:68457168-68457190 AAACCCCACTGAAGGGGTACGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1150823733_1150823753 29 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823753 17:68457169-68457191 AACCCCACTGAAGGGGTACGGGG 0: 1
1: 0
2: 1
3: 12
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150823733 Original CRISPR AGTGTCCTCCCAGAGCGACA AGG (reversed) Intronic