ID: 1150823748

View in Genome Browser
Species Human (GRCh38)
Location 17:68457160-68457182
Sequence GGTGCGGCAAACCCCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150823732_1150823748 24 Left 1150823732 17:68457113-68457135 CCAACCTTGTCGCTCTGGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823730_1150823748 25 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823733_1150823748 20 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150823748 Original CRISPR GGTGCGGCAAACCCCACTGA AGG Intronic
900405865 1:2492750-2492772 GGGATGGCAAATCCCACTGAGGG + Intronic
913050681 1:115114379-115114401 GGTGAGGCAAGGCCCACTGTGGG - Intergenic
918154997 1:181836071-181836093 GCTGCAGCAAACCCCACCCAAGG + Intergenic
923173994 1:231445667-231445689 GCTGCAGCAAACCCCACCCAAGG + Intergenic
923272401 1:232369608-232369630 GCTGCGGCAAATCCCAATGCTGG + Intergenic
1065518925 10:26552918-26552940 GGTGGGGCAGATACCACTGAGGG - Intronic
1078509824 11:11976959-11976981 GGGGCCCCAAACCTCACTGAGGG + Intronic
1091309372 11:134561633-134561655 GGAGAGGCAAACCGCCCTGAGGG - Intergenic
1104898115 12:132174086-132174108 TGTGCGGCAACCCACACTGGGGG - Intergenic
1113653794 13:112056079-112056101 GGCGCGGAAAACCCCAGGGAAGG + Intergenic
1114592517 14:23880087-23880109 GATCCAGCAAATCCCACTGATGG + Intergenic
1118739212 14:68726681-68726703 GGTGGGGGAAAACTCACTGAGGG - Intronic
1119650965 14:76382438-76382460 GGTGGGGCAGACCCCAGAGAGGG + Intronic
1124385901 15:29207944-29207966 GGTGGGGTGACCCCCACTGATGG - Intronic
1124895130 15:33769440-33769462 AATGTGGCAAACCCCACTGGTGG + Intronic
1148475317 17:47924964-47924986 GGTGGGGCTCAGCCCACTGATGG - Exonic
1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG + Intronic
1151763549 17:76121098-76121120 GGTTCTGCAAACCCCACCGCAGG + Intronic
1154500762 18:14996739-14996761 GGTGGGACAAACCCCATTGCTGG + Intergenic
1156326664 18:36079728-36079750 GCTGCAGCAAACCCCACTCAAGG + Intergenic
1157507527 18:48239154-48239176 GCTGCAGCAAGCCCCACTCAAGG + Intronic
1157619382 18:49007333-49007355 GGTTCTGCAAACTCCACTGCAGG - Intergenic
1161016566 19:1986441-1986463 GCTGCGGCTATCCCCACGGAGGG + Exonic
1163312559 19:16522894-16522916 GGTTCGGCACCTCCCACTGACGG + Intronic
1167667795 19:50832821-50832843 GGGGAGGCAGACACCACTGAGGG - Intronic
925639027 2:5969585-5969607 GGCGGTGCAGACCCCACTGAAGG - Intergenic
925871133 2:8271692-8271714 AGAGCCACAAACCCCACTGATGG - Intergenic
937451282 2:122003678-122003700 TGTGCAGCTAACACCACTGAAGG - Intergenic
938499961 2:131827068-131827090 GGTGGGACAAACCCCATTGCTGG + Intergenic
938540146 2:132278828-132278850 GGTGGGGCACACCCCACCAAGGG + Intergenic
947916582 2:233836105-233836127 GGTGCTGCAGACCTCACAGACGG - Intronic
948370072 2:237483283-237483305 GGTCAGGCAAGTCCCACTGAGGG - Intergenic
1171078718 20:22155995-22156017 GATACCGCAGACCCCACTGAGGG + Intergenic
1171869083 20:30511849-30511871 GGTGGGGCACACCCCACCCAGGG + Intergenic
1173591339 20:44227483-44227505 GGTGCCCCAAACACCACTGGTGG - Intergenic
1175912878 20:62413087-62413109 GGGGCGGGAACCCCAACTGATGG - Intronic
1181931437 22:26404916-26404938 TGTGGGGCAACTCCCACTGAGGG - Intergenic
1184514560 22:44954037-44954059 GGTGGGCCACACCCCACTGGGGG - Intronic
1185250357 22:49798638-49798660 GCTGCGGCTGACCCCGCTGACGG - Exonic
950113257 3:10434092-10434114 GGTGGGGCATACCCCACTAGGGG + Intronic
951467762 3:23020456-23020478 GATGCAGCAAACCCCACCCAAGG + Intergenic
953185302 3:40631805-40631827 GCTGCAGCAAACCCCACCCAAGG + Intergenic
964867347 3:161276117-161276139 GGTGCAGCAAGCCCCACCCAAGG + Intergenic
968664835 4:1815353-1815375 GGTGCAGCAAACACCTCTCAGGG - Intronic
970005666 4:11408570-11408592 GGTGAGGCAGGCCCCAGTGAAGG + Intronic
970856153 4:20651277-20651299 GCTGCAGCAAGCCCCACTCAGGG + Intergenic
975243790 4:72094501-72094523 GCTGCAGCAAGCCCCACTCAAGG - Intronic
979160035 4:117448306-117448328 GCTGCAGCAAGCCCCACTCAAGG - Intergenic
985673905 5:1220508-1220530 CGTCCTGCAAACCCCACTGCTGG - Intronic
986617884 5:9638777-9638799 GCTGTGGCAAGCCCCACTCAAGG - Intronic
996994041 5:129672707-129672729 GGTGCTGCAAACCCATATGAGGG - Intronic
998299157 5:141001671-141001693 GGTCCAACAAACCCCACAGATGG + Intronic
1002048309 5:176554356-176554378 GGTGAGGACAACCCCACGGAAGG + Intronic
1003209085 6:4043456-4043478 TCTGCTGCAGACCCCACTGATGG - Intronic
1005146038 6:22691166-22691188 GCTGTGGTAAACCCCACTCAAGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006150214 6:31983056-31983078 GGTGGGTCAAACTCCACAGAGGG - Intronic
1006156515 6:32015794-32015816 GGTGGGTCAAACTCCACAGAGGG - Intronic
1009552680 6:65119563-65119585 AGTGTGGCAAACCCCAGTGGAGG - Intronic
1023224854 7:37958694-37958716 GGTCCAGCAGAGCCCACTGAGGG - Intronic
1025963978 7:66250624-66250646 GATGCCCGAAACCCCACTGATGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1032291609 7:130593371-130593393 GAAGAGGCAAACTCCACTGAAGG + Intronic
1033617349 7:143029362-143029384 GTTGCTGCAATCCCCACTCATGG + Intergenic
1048284471 8:133131025-133131047 GGTGAGTCATACCCCACTGCCGG - Intronic
1055480961 9:76708822-76708844 GGTGCGGCAATCCCCAGTGATGG - Exonic
1057720395 9:97527654-97527676 GGGGCGGCAAGGCCGACTGACGG + Intronic
1062601896 9:137322081-137322103 GGTGCGGCAGTTCCCACTCAGGG + Intronic
1185499411 X:585432-585454 TGAGCTGCAAACCCCAATGAGGG + Intergenic
1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG + Intergenic
1194515975 X:94854666-94854688 GCTGCAGCAAACCCCACTTGAGG + Intergenic
1197055484 X:122113751-122113773 GCTGCAGCAAGCCCCACTCAAGG - Intergenic
1197081748 X:122426446-122426468 GGTGCAGCAAACCTCACCCAAGG - Intergenic