ID: 1150823748

View in Genome Browser
Species Human (GRCh38)
Location 17:68457160-68457182
Sequence GGTGCGGCAAACCCCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150823733_1150823748 20 Left 1150823733 17:68457117-68457139 CCTTGTCGCTCTGGGAGGACACT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823732_1150823748 24 Left 1150823732 17:68457113-68457135 CCAACCTTGTCGCTCTGGGAGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1150823730_1150823748 25 Left 1150823730 17:68457112-68457134 CCCAACCTTGTCGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 113
Right 1150823748 17:68457160-68457182 GGTGCGGCAAACCCCACTGAAGG 0: 1
1: 0
2: 1
3: 1
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150823748 Original CRISPR GGTGCGGCAAACCCCACTGA AGG Intronic