ID: 1150824566

View in Genome Browser
Species Human (GRCh38)
Location 17:68463203-68463225
Sequence GGGGACACCTCAGGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150824557_1150824566 17 Left 1150824557 17:68463163-68463185 CCATCTAGTGGTCTGTATGATTT No data
Right 1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150824566 Original CRISPR GGGGACACCTCAGGAAAAAC TGG Intergenic
No off target data available for this crispr