ID: 1150831420

View in Genome Browser
Species Human (GRCh38)
Location 17:68523306-68523328
Sequence CAGCATAACTCAAAATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 443}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150831420_1150831425 8 Left 1150831420 17:68523306-68523328 CCAGGCTATTTTGAGTTATGCTG 0: 1
1: 0
2: 2
3: 83
4: 443
Right 1150831425 17:68523337-68523359 AAAGGGGAACAGAATTGTCCTGG 0: 1
1: 1
2: 1
3: 23
4: 253
1150831420_1150831421 -10 Left 1150831420 17:68523306-68523328 CCAGGCTATTTTGAGTTATGCTG 0: 1
1: 0
2: 2
3: 83
4: 443
Right 1150831421 17:68523319-68523341 AGTTATGCTGTTAGCCTTAAAGG 0: 1
1: 0
2: 0
3: 27
4: 335
1150831420_1150831423 -8 Left 1150831420 17:68523306-68523328 CCAGGCTATTTTGAGTTATGCTG 0: 1
1: 0
2: 2
3: 83
4: 443
Right 1150831423 17:68523321-68523343 TTATGCTGTTAGCCTTAAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1150831420_1150831422 -9 Left 1150831420 17:68523306-68523328 CCAGGCTATTTTGAGTTATGCTG 0: 1
1: 0
2: 2
3: 83
4: 443
Right 1150831422 17:68523320-68523342 GTTATGCTGTTAGCCTTAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1150831420_1150831426 17 Left 1150831420 17:68523306-68523328 CCAGGCTATTTTGAGTTATGCTG 0: 1
1: 0
2: 2
3: 83
4: 443
Right 1150831426 17:68523346-68523368 CAGAATTGTCCTGGCACTTGAGG 0: 1
1: 0
2: 1
3: 29
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150831420 Original CRISPR CAGCATAACTCAAAATAGCC TGG (reversed) Intronic
901799059 1:11696873-11696895 CAAAACAAATCAAAATAGCCAGG + Intronic
901958748 1:12808026-12808048 CATAATAACTCAAGATACCCTGG - Intergenic
903433886 1:23331671-23331693 GAGCAAAACACAAAATAGCTGGG + Intronic
906454283 1:45980404-45980426 CAGCATCACGCAATATACCCAGG + Intronic
906850913 1:49249782-49249804 CAGCATTATTCACAATAGTCAGG + Intronic
907017234 1:51028811-51028833 CAGCATCACACAATATACCCAGG - Intergenic
907624564 1:56016517-56016539 CAGCATTATTTACAATAGCCAGG + Intergenic
908042383 1:60128513-60128535 CAGCATCACACAATATACCCAGG - Intergenic
908319878 1:62968786-62968808 CAGCATCACACAATATACCCAGG + Intergenic
908554134 1:65240177-65240199 CAGCATCACACAATATACCCAGG - Intergenic
909364130 1:74799519-74799541 TTGCATAACTAAAAAGAGCCAGG - Intergenic
909703168 1:78550881-78550903 CAGCATCACACAATATAGCTAGG + Intergenic
910568286 1:88670675-88670697 AACCAGAACTCAAAATTGCCTGG - Intergenic
911214274 1:95175464-95175486 CAGCATTATTCACAATAGCCAGG - Intronic
912123438 1:106503029-106503051 CAACATAACTTAAAATTGCAGGG + Intergenic
912219489 1:107656573-107656595 TTGCATATTTCAAAATAGCCAGG + Intronic
912934333 1:113989604-113989626 TAGCAAAAGTCAAATTAGCCAGG - Intergenic
913698477 1:121351307-121351329 CAGCATTATTCAAAATAACCAGG + Intronic
914139071 1:144928736-144928758 CAGCATTATTCAAAATAACCAGG - Intronic
914808584 1:151009548-151009570 CAGTATAACTCAAAGTAGAGGGG - Intronic
916241461 1:162643990-162644012 CATCATATCTCTTAATAGCCAGG - Intronic
916609399 1:166376157-166376179 CAGCATCACACAATATATCCAGG - Intergenic
916736622 1:167613303-167613325 AAGCATTATTCACAATAGCCTGG - Intergenic
916907448 1:169302706-169302728 CAGCATCACACAATATACCCAGG + Intronic
917388565 1:174505861-174505883 CAGTATTAATCACAATAGCCAGG + Intronic
917517110 1:175717381-175717403 CAGCATCACGCAATATACCCAGG + Intronic
917820218 1:178755236-178755258 CAGCATAACACAATATACCCAGG - Intronic
917826648 1:178828982-178829004 CAGCATTATTCACAATAGCCAGG + Intronic
918321794 1:183371670-183371692 CAGCAGAGCTCAGAATACCCTGG - Intronic
918630553 1:186712481-186712503 AAGCAAAACTGAAAATATCCAGG - Intergenic
919792002 1:201297819-201297841 CAGCCTAGCTCAAAAGAGGCAGG + Intronic
919830426 1:201537026-201537048 CAGCATCACACAATATACCCAGG - Intergenic
920485881 1:206369963-206369985 CAGCATTATTCAAAATAACCAGG + Intronic
921917621 1:220629877-220629899 CAGCATTAGTCACAAAAGCCAGG - Intronic
922549859 1:226486116-226486138 CAGCACTATTCACAATAGCCAGG - Intergenic
922796940 1:228344892-228344914 CAGCATCAGTCAGATTAGCCAGG - Intronic
923088341 1:230719128-230719150 CAGCATTATTCACAATAGCCAGG - Intergenic
923175934 1:231465055-231465077 CAGCATTATTCACAATAGCCAGG + Intergenic
923223913 1:231921668-231921690 CAGCATACCTCAATAAAGCTGGG - Intronic
923734189 1:236586533-236586555 CAGCTTAACTGACAATATCCTGG + Intronic
923833381 1:237582482-237582504 CAGCATAACACTATATACCCAGG - Intronic
924022310 1:239797294-239797316 CAGCATCACGCAATATATCCAGG + Intronic
924677925 1:246199492-246199514 AAACAAAACTTAAAATAGCCTGG - Intronic
1063625404 10:7685026-7685048 CAGCATCACACAATATATCCAGG + Intergenic
1063747098 10:8896813-8896835 CAGCATCACACAATATACCCAGG - Intergenic
1063937194 10:11090119-11090141 CAGCATCACGCAATATACCCAGG + Intronic
1065708206 10:28490525-28490547 CAGCACTGCTCACAATAGCCAGG - Intergenic
1066014308 10:31223198-31223220 CACCATAAGTAAAAGTAGCCTGG + Intergenic
1066198093 10:33121226-33121248 TAGCATTATTCAAAGTAGCCAGG - Intergenic
1066402025 10:35085945-35085967 CAGCATCACACAATATACCCGGG + Intronic
1066565486 10:36717580-36717602 GAGCATTATTCACAATAGCCAGG - Intergenic
1066656162 10:37701384-37701406 CAGCCTGACCCAAAATAGCCTGG - Intergenic
1066680306 10:37931663-37931685 CAAAAAAACACAAAATAGCCAGG - Intergenic
1066995595 10:42560119-42560141 CAGCACAGCTCAAAGAAGCCAGG - Intergenic
1067040650 10:42951640-42951662 CAGCCTGACCCAAAATAGCCTGG - Intergenic
1068418792 10:56762288-56762310 CAGCATCACACAATATACCCAGG + Intergenic
1069001733 10:63274402-63274424 AAGAATAAATAAAAATAGCCAGG + Intronic
1069275538 10:66586924-66586946 CAGTAGAATTCAGAATAGCCTGG - Intronic
1070352612 10:75607953-75607975 CAGCATTATTCACAATAGCTAGG - Intronic
1070858169 10:79626009-79626031 CAGCACTACTCACAATAGCAAGG + Intergenic
1071876278 10:89846721-89846743 GAGCATAACACAAACTACCCTGG + Intergenic
1072092131 10:92138912-92138934 CAGCACTATTCACAATAGCCAGG + Intronic
1072282988 10:93886592-93886614 CAGCACTATTCACAATAGCCAGG + Intergenic
1072417077 10:95257855-95257877 CAGCATTACTCACAATAGCCAGG + Intronic
1072862928 10:99025412-99025434 CAGCATTATTCACAATAGCAAGG + Intronic
1073999062 10:109349777-109349799 CAGCATATCACAATATACCCAGG - Intergenic
1074176839 10:111015167-111015189 TAGCATAATTCAAAATAAACTGG + Intergenic
1074444797 10:113512752-113512774 AAGCAAAACCCAAAATAGCCAGG + Intergenic
1074655056 10:115576165-115576187 CAGCATTATCCACAATAGCCAGG - Intronic
1075102743 10:119517724-119517746 CAGAATCACTCAAGATATCCTGG - Intronic
1075232070 10:120689019-120689041 GAGCATCACTCACCATAGCCCGG - Intergenic
1075569754 10:123531348-123531370 CAGCATCACTTAACATACCCAGG - Intergenic
1075821206 10:125313690-125313712 CAGCATCACGCAATATACCCAGG + Intergenic
1076699418 10:132263533-132263555 CAGCATCACGCAATATACCCAGG + Intronic
1077971213 11:7192983-7193005 CAGCATTATTTACAATAGCCAGG - Intergenic
1079406687 11:20153806-20153828 CAGTATTATTCACAATAGCCAGG - Intergenic
1080224289 11:29943310-29943332 CAGCATAATTCAGAGCAGCCTGG + Intergenic
1081311860 11:41583998-41584020 CAACAGAAATGAAAATAGCCAGG - Intergenic
1082111046 11:48274411-48274433 CAGCATTTTTCACAATAGCCAGG - Intergenic
1083366289 11:62143412-62143434 CAGCCTAACTCAACACAGCCTGG - Intronic
1083392472 11:62364556-62364578 CAGCATTATTCAAAATAGCCAGG + Intronic
1083530281 11:63415064-63415086 CAGCATCACACAATATATCCAGG + Intergenic
1084691295 11:70728415-70728437 CAATATAACTCAAGACAGCCTGG + Intronic
1085138106 11:74113009-74113031 CAGCATTATGCAAAATTGCCAGG + Intronic
1086310792 11:85534391-85534413 CAGCATCACACAATATACCCGGG - Intronic
1086888121 11:92226248-92226270 CAGCACAGCTAAAAATATCCGGG - Intergenic
1087054751 11:93922683-93922705 AAGCAAAACTCAAAAAAGCATGG - Intergenic
1087113102 11:94493424-94493446 CAGGATGACTGAAAATAGCCAGG + Intronic
1088323435 11:108577171-108577193 CAGCACTATTCACAATAGCCAGG - Intronic
1089948527 11:122503323-122503345 AAGCATTATTCATAATAGCCAGG - Intergenic
1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG + Intronic
1093288355 12:17294431-17294453 CAGCAAAAATTACAATAGCCTGG - Intergenic
1093299321 12:17434773-17434795 CAGCAGTATTCAAAATAGCAAGG - Intergenic
1093697616 12:22179949-22179971 CAGCATTATTCAAAACAGCCAGG + Intronic
1093810208 12:23483431-23483453 CAGCATCACTCAATATACCCAGG + Intergenic
1093923342 12:24884062-24884084 TAGCATTATTCACAATAGCCAGG + Intronic
1094355283 12:29571258-29571280 CATAATAACTAAATATAGCCTGG - Intronic
1094426454 12:30321529-30321551 CAGCATACCTCAAGATAGATGGG + Intergenic
1094759357 12:33512599-33512621 CAGCACAGTTCAAAATAGCAAGG - Intergenic
1095121787 12:38427582-38427604 CAGCAGAACTCAAAACAGGCAGG - Intergenic
1095141125 12:38663685-38663707 CAGCATTATTCACAATAGCCAGG + Intronic
1095144166 12:38704197-38704219 CAGCATCACACAATATATCCAGG + Intronic
1095228852 12:39709770-39709792 CAGCATTATTCACAATAGCCAGG - Intronic
1095551972 12:43453144-43453166 CAGCATAAGTCAAAATAACATGG - Intronic
1096376490 12:51115610-51115632 CAGCATTATTCACAATAGCCAGG + Intronic
1097509962 12:60527218-60527240 CAGCATTATTCACAATAGCAAGG - Intergenic
1097623831 12:61975600-61975622 CAGCATTATTCACAATAGCCAGG - Intronic
1098738343 12:74136966-74136988 CAGCACAATTCAAAATAGCAAGG - Intergenic
1098740537 12:74168568-74168590 CAGCATCACACAATATACCCAGG + Intergenic
1099265858 12:80446847-80446869 CAGCATTATTCACAATAGCAAGG - Intronic
1100675909 12:96867465-96867487 CAGCATTACTCTCAATAGCCAGG + Intronic
1100780302 12:98018291-98018313 CAGCATTATTCACAATATCCAGG + Intergenic
1102126493 12:110486433-110486455 CAGCACAGCTCACAAAAGCCAGG + Exonic
1103115407 12:118325153-118325175 CAGCACTATTCACAATAGCCAGG - Intronic
1103667623 12:122582549-122582571 CAGCATCACACAATATACCCAGG + Intronic
1104330458 12:127839610-127839632 CAGCACTACTCACAATAGCAAGG + Intergenic
1104883580 12:132089671-132089693 CAGCATTATTCACAGTAGCCTGG - Intronic
1105388219 13:19951948-19951970 CAGTATTATTCACAATAGCCAGG + Intergenic
1105449867 13:20489855-20489877 CAGCATTATTCACAATAGCCAGG + Intronic
1105852934 13:24351684-24351706 CAGCAGCAATCAGAATAGCCTGG - Intergenic
1107006072 13:35613478-35613500 CAGCATTATTCATAATAGCCAGG - Intronic
1107471358 13:40694338-40694360 CAGCATCATGCAATATAGCCAGG + Intergenic
1107487739 13:40845907-40845929 CAGCATCACACAATATATCCAGG + Intergenic
1108451457 13:50570309-50570331 TAGCCAAACTCAAAATAGCAAGG + Intronic
1108483228 13:50897000-50897022 CAACACAATTCACAATAGCCAGG + Intergenic
1109041255 13:57340161-57340183 CAGTATTATTCACAATAGCCAGG + Intergenic
1109041340 13:57341500-57341522 CAGTATTATTCACAATAGCCAGG + Intergenic
1109069271 13:57743085-57743107 CAACAAAACTCAAATTAGCCTGG + Intergenic
1109150035 13:58835659-58835681 CAGCATCACACAATATAACCAGG - Intergenic
1109181420 13:59218541-59218563 CAGCATCACACAATATACCCAGG + Intergenic
1109191884 13:59334580-59334602 CAGCATTACTCACAATATCCAGG + Intergenic
1110228999 13:73148825-73148847 CAGCATCACACAATATACCCAGG + Intergenic
1110876321 13:80515191-80515213 CAGCATCACGCAATATACCCAGG - Intergenic
1111042184 13:82762908-82762930 CAGCATTATTCACAATAGCAAGG + Intergenic
1111155825 13:84323304-84323326 CAGCATCAGTCACAATAGCCAGG + Intergenic
1114434371 14:22692027-22692049 CAGCACTACTCACAATAGCAAGG - Intergenic
1114512511 14:23274610-23274632 CATAAGAACTGAAAATAGCCGGG + Exonic
1114746840 14:25157442-25157464 CAGCATCACACAATATACCCAGG - Intergenic
1115047584 14:29015311-29015333 CAGCACAATTCACAATAGCACGG - Intergenic
1115705810 14:35997087-35997109 CAGCATTATTCACAATAGCCAGG - Intergenic
1115708573 14:36025005-36025027 CAGCACTATTCACAATAGCCAGG - Intergenic
1116813239 14:49559884-49559906 CAGCATTACCCAATATACCCAGG - Intergenic
1116855989 14:49952773-49952795 CAGCTTAAATCAAATTAGTCAGG + Intergenic
1118104653 14:62643995-62644017 CAGCACTAGTCACAATAGCCAGG + Intergenic
1118888109 14:69883556-69883578 CAGCATTGTTCACAATAGCCAGG - Intronic
1119629444 14:76214929-76214951 CAGCATCACGCAATATACCCAGG - Intronic
1120236320 14:81895529-81895551 CAGCATTATTCACAATAGCCAGG - Intergenic
1120972954 14:90224275-90224297 CAGCATTTTTCACAATAGCCGGG + Intergenic
1121177635 14:91903020-91903042 CAGCATCACACAAAATACCTAGG + Intronic
1121178603 14:91910085-91910107 CAGCATTATTCACAATAGCCAGG + Intronic
1122185525 14:99990784-99990806 CAGAATTATTCACAATAGCCAGG - Intronic
1123161261 14:106280378-106280400 AAAAATACCTCAAAATAGCCTGG + Intergenic
1123803580 15:23848579-23848601 CAGCATGATTCACAATAGCCAGG - Intergenic
1124004017 15:25782018-25782040 CAGCATCACTCAGAATTGCTAGG + Intronic
1124010816 15:25837234-25837256 CAGCATTATTCAAAAGAACCAGG + Intronic
1124247227 15:28081174-28081196 CAGCATCACACAATATACCCAGG + Intronic
1125126400 15:36227160-36227182 CAGCATCACACAACATACCCAGG + Intergenic
1125306197 15:38318497-38318519 CAGCATTACCCAATATACCCAGG - Intronic
1125619131 15:41043424-41043446 CAGCATTACTCCAAACAGGCTGG + Intronic
1126540674 15:49819208-49819230 CAGCATCACACAACATACCCAGG + Intergenic
1127728508 15:61776108-61776130 CAGCATCCCACAATATAGCCAGG + Intergenic
1128259526 15:66223049-66223071 CAGCATTATTCATAATAGCCAGG + Intronic
1130366322 15:83242897-83242919 AAGCATAACTCCAAATAGTGGGG + Intergenic
1130728918 15:86469510-86469532 CAGCACTACTCACAATAGCCAGG - Intronic
1131085058 15:89568986-89569008 CAGCATCACACAATATAGCCAGG - Intergenic
1132094804 15:98975030-98975052 CAGCATTATTCATAATAGCCAGG + Intronic
1132438792 15:101837821-101837843 CAGCACTACTCACAATAGCCAGG - Intergenic
1132686834 16:1165748-1165770 CAGCACAACTCAGGAGAGCCGGG - Intronic
1133486850 16:6228001-6228023 CAGCACTATTCAAACTAGCCAGG + Intronic
1133865880 16:9642999-9643021 CAGCATCACGCAATATATCCAGG + Intergenic
1135951805 16:26921239-26921261 CAGCACAACTCACAATTGCAAGG + Intergenic
1135979637 16:27137460-27137482 AAGCAAAGCTCAAAATAACCTGG + Intergenic
1136252564 16:29015474-29015496 CAGCATTGCTCACAGTAGCCAGG - Intergenic
1136602245 16:31300210-31300232 CAGCACTATTCACAATAGCCAGG - Intronic
1138751021 16:59421031-59421053 CAGCATAATTCACAATTGCAAGG - Intergenic
1139298571 16:65923955-65923977 CAGCATAACAGAAAATGGACTGG - Intergenic
1140097975 16:71891836-71891858 CATCTTTACTAAAAATAGCCAGG + Intronic
1143002438 17:3803074-3803096 GAGCATTACTCAACAGAGCCTGG - Intergenic
1144121499 17:12158336-12158358 CAGCATTATTCACAATAGCCAGG - Intergenic
1144411328 17:15004937-15004959 CAGCATCACCTAAAATTGCCTGG - Intergenic
1144504253 17:15816795-15816817 CAGCATAACTTACAACAGCAAGG + Intergenic
1144627644 17:16852548-16852570 CAGCATAACTTACAACAGCAAGG + Intergenic
1144634002 17:16892424-16892446 CAGCATAACTTACAATAGCAAGG + Intergenic
1144792388 17:17867697-17867719 CAGCATAACTCACTAAAGCTGGG - Intronic
1144878798 17:18420174-18420196 CAGCATAACTTACAACAGCAAGG - Intergenic
1145153438 17:20524220-20524242 CAGCATAACTTACAACAGCAAGG + Intergenic
1145168108 17:20632302-20632324 CAGCATAACTTACAACAGCAAGG + Intergenic
1145298499 17:21613349-21613371 CAGTATAACCCCAGATAGCCAGG - Intergenic
1146164192 17:30575236-30575258 CAGCATAACTTACAACAGCAAGG + Intergenic
1147340250 17:39749516-39749538 CAGCATTACTCAATATACCCAGG - Intergenic
1147472796 17:40679279-40679301 CAGCATCACACAATATACCCTGG - Intergenic
1149219655 17:54402039-54402061 CAGAAAAACTCAAAATATACTGG - Intergenic
1150513578 17:65782908-65782930 CAGCATCACGCAATATACCCAGG + Intronic
1150544596 17:66141811-66141833 CAGCATTATTCACAATAGTCAGG - Intronic
1150831420 17:68523306-68523328 CAGCATAACTCAAAATAGCCTGG - Intronic
1150989222 17:70236302-70236324 CAGAATAACTAAACATAGTCTGG - Intergenic
1151365745 17:73614921-73614943 CAGCATCACACAATATATCCAGG + Intronic
1153362941 18:4218903-4218925 CAGCATTATTCACAATAGCTAGG - Intronic
1153631402 18:7073690-7073712 CAGCATTATTCACAGTAGCCAGG - Intronic
1153654546 18:7271351-7271373 CAGCATCACACAATATACCCCGG + Intergenic
1154124523 18:11678477-11678499 CAGCACTACTCACAGTAGCCAGG + Intergenic
1154238076 18:12624866-12624888 CAGAATAACTCAAATTATCTGGG - Intronic
1155029747 18:21973842-21973864 CAGCATCACACAATATACCCAGG - Intergenic
1155550441 18:26959411-26959433 CAGCATCACACAAGATACCCAGG + Intronic
1155557426 18:27035402-27035424 CAGCATTATTCAAAATAGCTAGG + Intronic
1155800637 18:30098736-30098758 AAGGATGACTCAAATTAGCCTGG - Intergenic
1155852053 18:30786303-30786325 CAGCATCACACAACATACCCAGG - Intergenic
1156176280 18:34550767-34550789 CAGTAGAACTCCAAATAGTCTGG + Intronic
1156779427 18:40833472-40833494 CAGCATTACACAACATAGCCAGG + Intergenic
1156927083 18:42595506-42595528 CAGCAGAAATCTTAATAGCCAGG - Intergenic
1156954978 18:42951520-42951542 CAGCATCACACAATATACCCAGG + Intronic
1159430099 18:68340345-68340367 CAGCATCACGCAATATACCCAGG + Intergenic
1161325888 19:3663932-3663954 CAGCACAATTCACAATGGCCAGG + Intronic
1161939953 19:7395895-7395917 CAGCATCACGCAATATATCCAGG - Intronic
1162214658 19:9123352-9123374 CAGTATTAGTCACAATAGCCAGG - Intergenic
1162869088 19:13572193-13572215 CAGCCCAACTCACAGTAGCCTGG - Intronic
1163892065 19:20025948-20025970 CAGAATAACTCAGAATATTCTGG - Intronic
1165643275 19:37408407-37408429 CAGCATCACACAATATACCCAGG - Intergenic
1166421207 19:42638643-42638665 CAGCATCACACAATATACCCAGG - Intronic
1166599758 19:44083674-44083696 CAGCATCACACAATATACCCAGG - Intronic
1166727091 19:45035166-45035188 CAGCAAAACCCAAAATAACAGGG + Intronic
1168499688 19:56883173-56883195 CAGCACTATTCACAATAGCCAGG - Intergenic
925113480 2:1355615-1355637 CAGCACTACTCACAATAGCCAGG - Intronic
925479873 2:4258466-4258488 CAGCATTATTCACAATAGTCAGG - Intergenic
926737924 2:16088350-16088372 CAGCATCACACAATATACCCAGG + Intergenic
927105716 2:19822008-19822030 CAGCATGACTCAATATACCCAGG + Intergenic
928472355 2:31586714-31586736 CAGCATAGATCAAAATACTCCGG + Intergenic
928845835 2:35670601-35670623 CAGCACTATTCATAATAGCCAGG - Intergenic
929275074 2:40016126-40016148 CAGCATAATTCAAGATACCCAGG + Intergenic
929329239 2:40659825-40659847 CAGCATCACCCAACATACCCAGG + Intergenic
929485656 2:42351810-42351832 CAGAATAACTAAAATTAGCCAGG + Intronic
929728793 2:44463419-44463441 CAGCATAGCTCATAATAGGGAGG + Intronic
930941521 2:57019960-57019982 CAGCATCACACAATATATCCAGG - Intergenic
931180372 2:59893438-59893460 CAGCACTATTCACAATAGCCAGG - Intergenic
932072270 2:68633231-68633253 CAGCATCACACAAAATACCTAGG - Intergenic
932632910 2:73362000-73362022 CATCATCACCCAAAATTGCCTGG + Intergenic
932930375 2:76029343-76029365 CAGCACTATTCATAATAGCCAGG - Intergenic
933007195 2:77010593-77010615 CAGCATTGTTCACAATAGCCAGG - Intronic
933088307 2:78085869-78085891 CAGCATCACACAATATACCCAGG - Intergenic
933452421 2:82472549-82472571 CAAAATTACTCAAAATAGGCCGG + Intergenic
934021594 2:87960413-87960435 CATCATTACTCAAAATAGGGAGG + Intergenic
934072672 2:88399080-88399102 CAGTATTATTCATAATAGCCAGG + Intergenic
934082121 2:88477765-88477787 CAGCATCACACAATATACCCAGG - Intergenic
934574973 2:95394325-95394347 CAGCAGAGCTCAAAGTGGCCAGG - Intergenic
935528926 2:104208685-104208707 CAACATAACTGATAATAGCAAGG + Intergenic
936120909 2:109743675-109743697 CAGCATCACACAATATACCCAGG - Intergenic
936223788 2:110627797-110627819 CAGCATCACACAATATACCCAGG + Intergenic
936459072 2:112698247-112698269 CAGCATCACGCAATATATCCAGG - Intergenic
937028359 2:118717829-118717851 AAGCATAACTCAAAAGAACAGGG + Intergenic
937468215 2:122153450-122153472 CAACATATCTCAAACTAGCCTGG + Intergenic
939125313 2:138171232-138171254 CAGCATCATGCAAAATATCCAGG + Intergenic
939503632 2:143016792-143016814 CAGCATCACACAATATACCCAGG - Intronic
941546003 2:166852443-166852465 CAGCACTACTCACAATAGCCAGG + Intergenic
941575631 2:167226704-167226726 TAGCATAACCCAAAGAAGCCTGG - Intronic
943147092 2:184059633-184059655 CAGTATCACTCAATATACCCAGG - Intergenic
943614138 2:190072357-190072379 CAGCATCACACAATATACCCAGG + Intronic
944959768 2:204858281-204858303 CAGCATTATCCACAATAGCCAGG + Intronic
946718037 2:222573860-222573882 CAGCATCACACAATATACCCAGG - Intronic
947683543 2:232059535-232059557 CAGCATCACACAATATAGTCAGG - Intronic
1168930267 20:1617252-1617274 CAGCATTATTTACAATAGCCAGG + Intronic
1169516870 20:6326312-6326334 CAGCATTACACAATATACCCAGG + Intergenic
1169944411 20:10973698-10973720 CAGCATCACACAATATATCCAGG - Intergenic
1170401946 20:15995939-15995961 CAGCATTATTCATAATATCCAGG - Intronic
1170699560 20:18691706-18691728 CAGCATCACACAATATACCCAGG + Intronic
1170908543 20:20540037-20540059 CAGCAGCATTCACAATAGCCAGG - Intronic
1171133321 20:22675049-22675071 CAGCATCACGCAATATACCCAGG + Intergenic
1174596960 20:51691806-51691828 CAGCATTATTCACAATAGCCAGG + Intronic
1175369623 20:58479324-58479346 CAGCACAACTCAATTTAGACAGG + Intronic
1177103446 21:16923815-16923837 CAGTATAAAACAAAATAGCGTGG - Intergenic
1177121125 21:17138213-17138235 CAGCATCACACAATATACCCAGG + Intergenic
1177389174 21:20444093-20444115 CTGAATAACTCAAAATAGTGTGG - Intergenic
1178364575 21:31978754-31978776 CAGCATTATTTACAATAGCCAGG - Intronic
1178468134 21:32867454-32867476 CAGCATTATTCACAATAGCCAGG - Intergenic
1178825343 21:36011297-36011319 CAGCATTATTCACAATAGCCAGG - Intergenic
1179393925 21:41020762-41020784 CAGCTTTATTCATAATAGCCAGG + Intergenic
1180743511 22:18070938-18070960 CAGCAGGACTCAAAATAGAAGGG + Intergenic
1181329207 22:22076018-22076040 CAGCACAACTCAAAGTAGTGGGG + Intergenic
1182156683 22:28080127-28080149 CAGTACTACTCATAATAGCCAGG - Intronic
1183490428 22:38112679-38112701 CAGCCTGACTCGAAAGAGCCTGG - Intronic
949100108 3:133171-133193 CAGCATATCTTAAAATTTCCTGG + Intergenic
949653028 3:6182913-6182935 CAGCATCACACAACATACCCAGG + Intergenic
949940997 3:9154331-9154353 CAACGTAACTCAAAATAGACTGG + Intronic
950895200 3:16443009-16443031 CAGCATTATTCACAATAGCCAGG - Intronic
951564884 3:24003378-24003400 CAGCATCACACAATATAGCCAGG - Intergenic
952475750 3:33708636-33708658 CACCATTATTCACAATAGCCAGG - Intronic
952593916 3:34990865-34990887 CAGCATCACTCAATATACCCAGG + Intergenic
952976031 3:38697312-38697334 CATCATAACTGAACATATCCAGG + Exonic
953104882 3:39867860-39867882 CAGCATTATTCACAATAGCCAGG + Intronic
955055747 3:55454602-55454624 CAGTATTATTCACAATAGCCAGG - Intergenic
955108390 3:55923092-55923114 GAGCATGATTCACAATAGCCAGG + Intronic
956259119 3:67317575-67317597 CAGCAAAACTCATAACAGCTGGG + Intergenic
956330340 3:68100092-68100114 CAGCATCACTCAATATACCCAGG + Intronic
957693609 3:83603637-83603659 CAGCATTATTCACAATAACCAGG - Intergenic
957791176 3:84942869-84942891 CAGTATAGATCAAAATACCCTGG - Intergenic
958010778 3:87876317-87876339 CAGCATTATTCACAATAGCTAGG + Intergenic
958070990 3:88611029-88611051 CAGCATACATCAAAATCACCCGG - Intergenic
958256280 3:91329438-91329460 CAGCATCACACAATATACCCAGG - Intergenic
958484666 3:94689392-94689414 CAGCACTATTCATAATAGCCAGG + Intergenic
958679772 3:97313319-97313341 CAGCATTATTCATAATAACCAGG - Intronic
959095899 3:101955294-101955316 CAGCATGACACAATATACCCAGG + Intergenic
959947561 3:112142782-112142804 CAGCATCACGCAATATACCCAGG - Intronic
960032544 3:113069466-113069488 CAGCATCACACAATATACCCAGG + Intergenic
960189705 3:114688324-114688346 CAGCATCACACAATATACCCAGG + Intronic
960791984 3:121442718-121442740 CAGCACTATTCACAATAGCCAGG - Intronic
960800778 3:121537350-121537372 CAGCATTACACAATATACCCAGG - Intronic
961089640 3:124099486-124099508 CAGCACTATTCACAATAGCCAGG - Intronic
961624340 3:128249858-128249880 CAGCATTATTCACAGTAGCCAGG - Intronic
962593066 3:136911181-136911203 CAGCATTATTCACAATAGCCAGG - Intronic
963762828 3:149301522-149301544 CAGCATTGTTCACAATAGCCAGG - Intergenic
964022766 3:152034097-152034119 CAGCACCACACAATATAGCCAGG + Intergenic
964660171 3:159111989-159112011 CAGCATTTCTCAAAATGGACTGG - Intronic
966319361 3:178684062-178684084 CAGCATTATTCACAGTAGCCAGG + Intronic
966329511 3:178794921-178794943 CAGCATCTCCCACAATAGCCAGG - Intronic
967423874 3:189304139-189304161 CAGCATAACACAAATTATTCTGG + Intronic
968257670 3:197292180-197292202 CAGCATTATTCACAACAGCCAGG + Intronic
968879140 4:3290081-3290103 CGGCACCACTCACAATAGCCGGG - Intergenic
969045930 4:4336724-4336746 CAGCCTCATTCACAATAGCCAGG + Intergenic
969537247 4:7764011-7764033 CAGCATGACTCACACCAGCCAGG + Intronic
970312991 4:14801843-14801865 CAGCATCACACAACATACCCAGG + Intergenic
970326151 4:14927211-14927233 CAGCATCACTCAATATACCCAGG - Intergenic
970923371 4:21421333-21421355 TAGCATTAGTCACAATAGCCAGG + Intronic
971041356 4:22755871-22755893 CACCATTATTCACAATAGCCAGG - Intergenic
972364042 4:38356963-38356985 GAGCATATCTCAAATGAGCCTGG + Intergenic
972434562 4:39020289-39020311 CAGCATTACTCACAATAGTCCGG - Intronic
972493798 4:39613892-39613914 TAACAAAATTCAAAATAGCCAGG + Intronic
972555186 4:40174448-40174470 CAGCATTACTTACAGTAGCCAGG + Intergenic
972864461 4:43213250-43213272 CGGCATTATTCACAATAGCCAGG - Intergenic
973811449 4:54574300-54574322 TAGCATAACTCCGAAAAGCCAGG - Intergenic
974990702 4:69084897-69084919 CAGCATTATTCACAATAGCAAGG - Intronic
975942398 4:79662515-79662537 CAGCATCACTCTATATACCCAGG + Intergenic
976049505 4:80994903-80994925 CGGCATTATTCACAATAGCCAGG - Intergenic
976486981 4:85618410-85618432 CAGCATTATTCACAATAGCCAGG - Intronic
976588427 4:86824624-86824646 CAGCATCACACAATATACCCAGG - Intronic
976703624 4:87998620-87998642 CAGCATCACACAATATACCCAGG + Intergenic
976912186 4:90321492-90321514 CAGCACTATTCACAATAGCCAGG - Intronic
978456392 4:108897158-108897180 AAGCATATCTCAAAATCTCCAGG + Intronic
979037713 4:115746607-115746629 CAGCATTGCACAATATAGCCAGG + Intergenic
979130563 4:117039380-117039402 CAGCATTATTCACAATAGCCAGG - Intergenic
979267174 4:118717096-118717118 CAGCATCACACAATATACCCAGG - Intergenic
979500661 4:121436126-121436148 CAGCACTATTCACAATAGCCAGG - Intergenic
979522144 4:121679734-121679756 CATCATAACTCAATAAAGCTGGG - Intronic
979574826 4:122277273-122277295 CATCATAGCTCACTATAGCCTGG - Intronic
980168580 4:129258638-129258660 CAGCATCACACAATATACCCAGG + Intergenic
980676705 4:136093547-136093569 CAGCATCACACAATATACCCAGG - Intergenic
980908049 4:138968179-138968201 CAGCATCACACAACATACCCAGG + Intergenic
981464374 4:145050682-145050704 CTGCATAACATAAAAGAGCCAGG - Intronic
981471015 4:145135037-145135059 CAGCATAAGGCAAAATCCCCTGG + Exonic
981553784 4:145969241-145969263 CAGCACAATTCACAATAGCCAGG + Intergenic
981556103 4:145996478-145996500 CAGCACTATTCACAATAGCCAGG - Intergenic
981992541 4:150939916-150939938 CACCATAACTCAATATATCAAGG + Intronic
982383821 4:154778870-154778892 CAGCCTAACTCAAAGTAGTTAGG + Intergenic
983024517 4:162716443-162716465 CAGCATTACTCAATATACCCAGG + Intergenic
983339356 4:166438514-166438536 CAGCATCACACAAGATACCCAGG - Intergenic
983541728 4:168918252-168918274 CAGCACTATTCATAATAGCCAGG + Intronic
984030548 4:174598973-174598995 CAGTATCATTCACAATAGCCAGG - Intergenic
984603248 4:181753384-181753406 CCCCATAACTCAAAACAGGCAGG + Intergenic
985206679 4:187545640-187545662 CAGCATTATTCATAAAAGCCAGG + Intergenic
986951628 5:13093526-13093548 CAGCACAATTCACAATGGCCAGG + Intergenic
989416543 5:41184068-41184090 CAGCATCACACAATAAAGCCAGG + Intronic
990913035 5:60872875-60872897 CAGCATTATTCACAATAGCCAGG + Intergenic
991134309 5:63163373-63163395 CAGCACAATTCACAATAGCAAGG - Intergenic
992002514 5:72449633-72449655 CAGCTTCACTCCAAATAACCAGG - Intronic
993246106 5:85454985-85455007 AAACATATCTCAAAATAGCAAGG - Intergenic
993512286 5:88786037-88786059 CTGCTTAACTAAAAATAGCCTGG - Intronic
994293849 5:98065043-98065065 CAGCTTAACTCTAATTAGCTAGG + Intergenic
995147430 5:108802407-108802429 CAGCATCACACAATATATCCAGG - Intronic
995782143 5:115788995-115789017 CAGCATCACTCAAAAGTGCAAGG - Intergenic
995785173 5:115820025-115820047 CAGCATCACACAATATACCCAGG - Intergenic
996560422 5:124822568-124822590 TAGCATTATTCACAATAGCCAGG + Intergenic
996829004 5:127719327-127719349 CAGCACTAGTCACAATAGCCAGG - Intergenic
997711937 5:136012806-136012828 AAGCACTACTCACAATAGCCAGG - Intergenic
997833039 5:137168909-137168931 CAGCATTATACACAATAGCCAGG + Intronic
998703608 5:144732941-144732963 CAGCATCACACAATATACCCAGG - Intergenic
998954018 5:147419810-147419832 CACCATAATTCAAAATATACTGG + Intronic
999346829 5:150830199-150830221 CAGCATCACACAATATACCCAGG + Intergenic
999392555 5:151204911-151204933 CAGCATCACCCAATATACCCAGG - Intronic
999509939 5:152239544-152239566 AAGCATTATTCACAATAGCCAGG + Intergenic
1000058413 5:157630680-157630702 AGGCAGAACTGAAAATAGCCTGG - Intronic
1000550177 5:162652385-162652407 CAGCACTATTCACAATAGCCAGG + Intergenic
1000822296 5:165999643-165999665 CAGCATCACACAATATACCCAGG - Intergenic
1003059330 6:2850539-2850561 CATCATAGCTCACTATAGCCTGG + Intergenic
1003750671 6:9051692-9051714 CAGCATCACACAATATACCCAGG + Intergenic
1003932592 6:10940390-10940412 CAGCATTATTCACAATAGCCAGG + Intronic
1003970410 6:11294105-11294127 CAACATTATTCACAATAGCCAGG - Intronic
1004039008 6:11956710-11956732 CAGCATCACACAATATACCCAGG - Intergenic
1004097076 6:12567093-12567115 CAGCATTATTAACAATAGCCAGG - Intergenic
1004655251 6:17653611-17653633 TAGCTTTACTCACAATAGCCAGG + Intronic
1006916656 6:37598969-37598991 CAGCACTACTCACAATAGCAAGG - Intergenic
1007438478 6:41836010-41836032 GATCATAACTCACAACAGCCTGG - Intronic
1007914496 6:45548665-45548687 AAGCAAAACTCTAAATCGCCAGG + Exonic
1008499678 6:52168799-52168821 CAGCATCACACAATACAGCCAGG + Intergenic
1008999055 6:57691721-57691743 CAGCATCACACAATATACCCAGG + Intergenic
1009187541 6:60591106-60591128 CAGCATCACACAATATACCCAGG + Intergenic
1009198499 6:60715868-60715890 CAGCATCATGCAAAATACCCAGG + Intergenic
1009461917 6:63923628-63923650 CAGCATCACGCAATATACCCAGG - Intronic
1009547746 6:65043812-65043834 CAGCATTATTCACAATAGTCAGG - Intronic
1009949986 6:70384276-70384298 CAGCATTATTCACAGTAGCCAGG - Intergenic
1010123590 6:72408028-72408050 CAGCACTATTCAAAATAGCAAGG - Intergenic
1010501404 6:76605252-76605274 CAGCATTATTCAATATACCCAGG + Intergenic
1010921020 6:81680727-81680749 CAGCATCACACAATATATCCAGG + Intronic
1011378136 6:86712821-86712843 CAGCATCACACAATATACCCAGG - Intergenic
1011666536 6:89639960-89639982 CAGTATAACTAAAAATGGCGAGG - Intergenic
1011731179 6:90265583-90265605 CAGAACAACTCAATATACCCAGG + Intronic
1012435833 6:99214420-99214442 CAGCATCACACAATATACCCAGG + Intergenic
1012769641 6:103415142-103415164 CAGCATAAAGAAAAATAGACCGG - Intergenic
1012986250 6:105879158-105879180 CAGCACTATTCACAATAGCCAGG + Intergenic
1013433146 6:110073935-110073957 CAGCATCACACAATATACCCAGG + Intergenic
1014433600 6:121397496-121397518 CAGCATCACACAATATACCCAGG - Intergenic
1014541868 6:122686084-122686106 CAGCATTATTCACAATAGCTAGG - Intronic
1016479097 6:144462339-144462361 CAGCACAATTCACAATAGCAAGG - Intronic
1017392793 6:153959146-153959168 TAGCATAACTAAAAAGACCCAGG - Intergenic
1018006771 6:159629656-159629678 CAGCATCACTCAATATACCCAGG - Intergenic
1018843738 6:167539426-167539448 CAGCATTACACAATATACCCCGG + Intergenic
1019963515 7:4480899-4480921 CAGCACTATTCACAATAGCCAGG - Intergenic
1020618889 7:10495352-10495374 CAGCATCACTCAATTTACCCAGG - Intergenic
1021085491 7:16417722-16417744 CAGCATCACACAATATACCCAGG + Intronic
1021137352 7:16981720-16981742 CAGCATCACACAATATACCCAGG - Intergenic
1022131700 7:27410735-27410757 CAGCATTATTCACAATAGCAAGG + Intergenic
1022813007 7:33887452-33887474 CAGCAGAGCTTAAAATATCCTGG - Intergenic
1022944261 7:35266387-35266409 CAGCATAATTTAAAAAAGACTGG + Intergenic
1023084013 7:36551959-36551981 CAGCATTACACAATATACCCAGG - Intronic
1023173062 7:37408471-37408493 CAGCGTTAGTCACAATAGCCAGG + Intronic
1023653564 7:42396260-42396282 CAGCATCACGCAATATAGCCAGG - Intergenic
1024514955 7:50241187-50241209 CAGCACAACTCACAATTGCAAGG + Intergenic
1024652128 7:51413163-51413185 CAGCACTACTCACAATAGCAAGG + Intergenic
1024814640 7:53254817-53254839 CAGCATCACACAATATATCCAGG - Intergenic
1024922490 7:54574405-54574427 GAGGATAACTCAAAATAGGAAGG - Intergenic
1026082395 7:67233479-67233501 CAGCCTGACTTAAAAAAGCCAGG - Intronic
1028696707 7:93722075-93722097 CAGCATCACACAATATACCCAGG + Intronic
1030834139 7:114262469-114262491 CAGCATCACTCAGTATACCCAGG + Intronic
1031143674 7:117973652-117973674 CAGCATCACACAATATACCCAGG - Intergenic
1031245015 7:119300465-119300487 CAACACAACTTAAAATAGCAAGG - Intergenic
1031283742 7:119839050-119839072 CAGAAGAAGTGAAAATAGCCAGG - Intergenic
1033010103 7:137612447-137612469 CAGCATACCTCAAAATCCCATGG + Intronic
1035408611 7:158618826-158618848 CAACATTATTCACAATAGCCAGG + Intergenic
1037667961 8:20987145-20987167 TAACATAACCCAAAATATCCAGG + Intergenic
1037923460 8:22825750-22825772 CAGCACTATTCACAATAGCCAGG + Intronic
1038362772 8:26899078-26899100 CAGCATCACTCAATAAACCCAGG - Intergenic
1038477937 8:27881617-27881639 CAGCATCACGCAATATACCCAGG + Intronic
1038604692 8:28988359-28988381 CAGCTTAGTTCAAAATAGTCAGG - Intronic
1038619828 8:29131266-29131288 CAGCATCACACAATATACCCAGG + Intronic
1038767254 8:30440593-30440615 CAGCATTATTCACAATAGCCAGG - Intronic
1038777296 8:30542646-30542668 CAGAATGTCTTAAAATAGCCTGG + Intronic
1038998016 8:32946554-32946576 CAGCATTATTCTCAATAGCCTGG - Intergenic
1041117778 8:54556883-54556905 CAACATTATTCACAATAGCCAGG + Intergenic
1041205032 8:55490504-55490526 CAGCATCACGCAATATACCCAGG + Intronic
1041579269 8:59438714-59438736 CAGCATCATGCAAAATACCCAGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043494817 8:80789448-80789470 GAGCATAACTAAAAATAGGCTGG + Intronic
1043815565 8:84796818-84796840 AGGAATAACTTAAAATAGCCTGG + Intronic
1043829929 8:84975701-84975723 CAGCACTATTCACAATAGCCAGG + Intergenic
1043983347 8:86665834-86665856 CAGCATCACCCAAGATACCCAGG + Intronic
1045066143 8:98446800-98446822 CTGCATCACTCACAATAGCAAGG + Intronic
1045209934 8:100086648-100086670 CAGCATGACGCAATATACCCAGG + Intronic
1045576212 8:103423260-103423282 CAGCATTATTCACAATACCCAGG + Intronic
1045625104 8:104036552-104036574 CAGCACAGCTCAAAATAGGAAGG + Intronic
1046003841 8:108455300-108455322 GGGCATAACTCAAAAGAGTCAGG - Intronic
1046150476 8:110217725-110217747 CAGCACTATTCACAATAGCCAGG + Intergenic
1046538068 8:115542214-115542236 CAGCATGACACAAAAATGCCCGG + Intronic
1046843028 8:118882567-118882589 CAGCATAAATGAAAATAGAATGG - Intergenic
1047595862 8:126377358-126377380 CTGCAAAACTCAAGACAGCCTGG + Intergenic
1047818913 8:128496686-128496708 CAGCAAAAATCAAAGTACCCTGG - Intergenic
1048047641 8:130788137-130788159 CAGCATCATTCACAATTGCCAGG - Intronic
1048052678 8:130833412-130833434 CAGCATTATTCACAATAGCCAGG - Intronic
1050055975 9:1655031-1655053 CAGCATCACACAATATACCCAGG - Intergenic
1050295793 9:4204036-4204058 CAGCATCACACAATATACCCAGG + Intronic
1050422275 9:5478120-5478142 CTGTATAACTCAAAATAACTAGG - Intergenic
1051126459 9:13810909-13810931 CTGCATAACTCAGGATAGGCTGG + Intergenic
1051457463 9:17276074-17276096 CAGCATCAAGCAATATAGCCAGG + Intronic
1051702814 9:19842588-19842610 CAGTATAGCTCAAAGTTGCCAGG - Intergenic
1051799565 9:20917280-20917302 CAACATAACTCATATTAGCAAGG - Intronic
1053140458 9:35679559-35679581 CAACAAAACCAAAAATAGCCGGG + Intronic
1053463287 9:38287367-38287389 CAGGCTCACTCAAAACAGCCTGG - Intergenic
1053593786 9:39539035-39539057 CAGCAGTACTCACGATAGCCAGG - Intergenic
1053851575 9:42294087-42294109 CAGCAGTACTCACAATAGCCAGG - Intergenic
1054572463 9:66825917-66825939 CAGCAGTACTCACGATAGCCAGG + Intergenic
1054985034 9:71252114-71252136 CAGCACTATTCACAATAGCCAGG - Intronic
1055262193 9:74450262-74450284 CAGCAGTATTCATAATAGCCAGG - Intergenic
1056054393 9:82805892-82805914 CAGGATTACTAGAAATAGCCTGG - Intergenic
1056182998 9:84103529-84103551 CAGCATCACACAATATACCCAGG + Intergenic
1056597643 9:88020874-88020896 CAGCATCACACAATATACCCAGG - Intergenic
1058181895 9:101808861-101808883 CATAATAATTCAAAATAGGCCGG + Intergenic
1058294580 9:103289613-103289635 CAGCATCATTCAATATACCCAGG + Intergenic
1058386935 9:104447366-104447388 CAGCATCACTTAAAGGAGCCAGG + Intergenic
1058555007 9:106157946-106157968 CAGCATAACTAATAATAAACAGG + Intergenic
1058628788 9:106964100-106964122 CAGCATTAGTTACAATAGCCAGG - Intronic
1058913417 9:109542070-109542092 CAGCATCACACAATATACCCAGG - Intergenic
1059971259 9:119670954-119670976 CAGCATGATTTACAATAGCCAGG + Intergenic
1203371465 Un_KI270442v1:309586-309608 CAGCATCACACAATATATCCAGG - Intergenic
1185854427 X:3520926-3520948 CAGCATCACTCAATGTACCCAGG - Intergenic
1185887344 X:3794632-3794654 CAGCATCATTCACTATAGCCTGG - Intergenic
1186046871 X:5545939-5545961 CAGCATCACACAATATACCCAGG - Intergenic
1186071111 X:5821647-5821669 CAGCATCACACAACATACCCAGG + Intergenic
1186386212 X:9112769-9112791 CAGCATCACGCAATATACCCAGG - Intronic
1186824337 X:13323588-13323610 CAGGATATCTCAAAATAGGAAGG - Intergenic
1188234292 X:27708057-27708079 CAGCATCACTCAATATATCCAGG - Intronic
1188328135 X:28832872-28832894 CAGCATCACACAATATAGCCAGG - Intronic
1189874667 X:45423355-45423377 CAGCATCACACAAAATACCCAGG + Intergenic
1190364758 X:49681297-49681319 CAGCACTATTCACAATAGCCAGG - Intergenic
1190531392 X:51381323-51381345 CAGCATTATTCACAATAGTCAGG + Intergenic
1190870092 X:54417593-54417615 CAGCATCACTAAATATACCCAGG + Intergenic
1190935592 X:54996550-54996572 AAGCCTAACTTAAAATTGCCTGG + Intronic
1190973188 X:55372585-55372607 CAGCATTACTCACAATAGCAAGG - Intergenic
1192522141 X:71812189-71812211 CAGTATTATTCACAATAGCCAGG - Intergenic
1192524100 X:71826736-71826758 CAGTATTATTCACAATAGCCAGG + Intergenic
1192842428 X:74871030-74871052 CAGCAGTATTCACAATAGCCAGG + Intronic
1193131031 X:77920061-77920083 CAGCATCATGCAATATAGCCAGG - Intronic
1193633057 X:83913135-83913157 CAGCATTATTCACAATAGCCAGG + Intergenic
1193639331 X:83992673-83992695 TAGCATTATTCATAATAGCCAGG + Intergenic
1193776434 X:85648435-85648457 CAGCATCACACAATATAGCCAGG + Intergenic
1194084924 X:89515063-89515085 CAGCATTACTAACAATAGCCAGG - Intergenic
1195058872 X:101174751-101174773 CAGCATCACACAATATACCCAGG + Intergenic
1195223673 X:102770365-102770387 CAGCATTATTCACAATAGCCAGG - Intergenic
1195250093 X:103035221-103035243 CAACATTATTCACAATAGCCAGG - Intergenic
1196601519 X:117606194-117606216 CAACACTATTCAAAATAGCCAGG + Intergenic
1197000548 X:121433987-121434009 CAGCATCACACAATATACCCAGG - Intergenic
1197193482 X:123674933-123674955 CAGCATCACACAATATACCCAGG + Intronic
1197258392 X:124288961-124288983 CAGCATTATTCACAATAGCCAGG - Intronic
1198148754 X:133886876-133886898 CAGCATTATTCACAAAAGCCAGG - Intronic
1198558297 X:137819657-137819679 CAGCATCACTCAATATATTCAGG + Intergenic
1199122930 X:144078686-144078708 CATCATTACTCAAAATAGGGAGG - Intergenic
1199215999 X:145261026-145261048 CAGCATCACTCAATGTACCCAGG - Intergenic
1199466452 X:148143286-148143308 CAGCACTAGTCACAATAGCCAGG - Intergenic
1199823543 X:151475076-151475098 CAGCATCACGCAATATATCCAGG - Intergenic
1200167750 X:154048903-154048925 CATCACAACTCCAAATAGCAGGG - Intronic
1200437575 Y:3170948-3170970 CAGCATTACTAACAGTAGCCAGG - Intergenic
1201632593 Y:16085591-16085613 CAGCATTACTCACAATTGCCAGG + Intergenic
1202299442 Y:23396141-23396163 CAGCACTATTCACAATAGCCAGG + Intergenic
1202571367 Y:26274457-26274479 CAGCACTATTCACAATAGCCAGG - Intergenic