ID: 1150840347

View in Genome Browser
Species Human (GRCh38)
Location 17:68600903-68600925
Sequence CCGAGTGAGCCGAGGGAATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150840339_1150840347 15 Left 1150840339 17:68600865-68600887 CCGGGGCTCTCGGAGTCAGCGGG 0: 1
1: 0
2: 1
3: 10
4: 107
Right 1150840347 17:68600903-68600925 CCGAGTGAGCCGAGGGAATGGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150840347 Original CRISPR CCGAGTGAGCCGAGGGAATG GGG Exonic
901749213 1:11395764-11395786 CCGAGAGAGCCGAGGGAGAGAGG - Intergenic
902375097 1:16026823-16026845 CCGAGGGAGCCCAGGGTGTGAGG - Intronic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
903534958 1:24060745-24060767 CCGAGTGATCTGTGGGGATGGGG - Intronic
904359843 1:29964153-29964175 CCTTGTGAGCAGAGAGAATGGGG + Intergenic
907394286 1:54178514-54178536 CTGAGTGAGCGGAGGGGATGTGG + Intronic
910366663 1:86472456-86472478 AAGACTGAGCCCAGGGAATGTGG - Intronic
916702184 1:167308541-167308563 CAGAGTGAGACCAGGGAAGGAGG - Intronic
920053357 1:203176272-203176294 CTGTGGGAGCCCAGGGAATGTGG - Intergenic
921010556 1:211136568-211136590 GTGAGTGAACCAAGGGAATGGGG - Intergenic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
922547109 1:226466063-226466085 CCCAGTGAGCCGAGGCAGGGTGG - Intergenic
923660648 1:235954483-235954505 CCCAGTGACTCAAGGGAATGAGG + Intergenic
1062931349 10:1354693-1354715 CCGAGAGAGGAGAGGGGATGTGG - Intronic
1063519033 10:6724270-6724292 CCGTTTGAGCCTAGAGAATGTGG + Intergenic
1081589147 11:44408853-44408875 AGGAGTGGGCAGAGGGAATGTGG + Intergenic
1083135853 11:60676403-60676425 CCCAGTGGGCTGAGGGAGTGGGG + Intergenic
1083553324 11:63607083-63607105 CCGACTGTGCTGATGGAATGAGG + Intronic
1085015572 11:73171947-73171969 CCGAGTGCTCCCAGGGAAAGGGG - Intergenic
1090259224 11:125306674-125306696 CCGAGTGTGCTGAGGCAGTGGGG + Intronic
1090315137 11:125779604-125779626 CTGAGTGAGCCAGGGAAATGTGG - Intergenic
1094500679 12:31018288-31018310 CTGAGTGGGCCTAGGGAAGGAGG + Intergenic
1105707841 13:22979574-22979596 CTGAGTGGGCCTGGGGAATGAGG + Intergenic
1105951071 13:25229899-25229921 CCGAGTGAGGTGAGGGGGTGTGG + Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123503625 15:20915489-20915511 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123560872 15:21489163-21489185 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1123597111 15:21926454-21926476 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1125770485 15:42162264-42162286 CCGAATGAGAAGAGGAAATGTGG - Intronic
1202969217 15_KI270727v1_random:216327-216349 CTGAGTGTGGCGAGGGAAGGTGG - Intergenic
1133059702 16:3166463-3166485 CTGAGTTAGCCGGGGGATTGTGG - Intergenic
1134022497 16:10930746-10930768 AAGAGTGAGTGGAGGGAATGGGG - Exonic
1140623407 16:76763505-76763527 CCTAGTGAGCTGTGGGAACGGGG + Intergenic
1142272342 16:89096729-89096751 CAGAGTCGGCCGAGGGAAGGGGG - Intronic
1144571019 17:16399089-16399111 CCCAGTGAGCTCAGGGCATGGGG - Intergenic
1150840347 17:68600903-68600925 CCGAGTGAGCCGAGGGAATGGGG + Exonic
1150920605 17:69478270-69478292 CTGAATGAGCTGAGGGAATGGGG - Intronic
1152243611 17:79173657-79173679 CCCAGTGAGCGGACGGGATGGGG - Intronic
1155511763 18:26584955-26584977 GGGAGTGAGCTGAGGGACTGTGG + Intronic
1156450872 18:37265967-37265989 CTGAGTGAGCAGAGGGCCTGGGG - Intronic
1157437626 18:47684208-47684230 ACTAGTGAGGAGAGGGAATGGGG - Intergenic
1157706740 18:49813688-49813710 CCGAGGGAGCCCAGGGGACGGGG + Exonic
1158099743 18:53817727-53817749 CTGACTTAGCCTAGGGAATGAGG - Intergenic
1161257257 19:3316295-3316317 CTGAGTGAGCCCAGGCAATCTGG + Intergenic
1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG + Intergenic
1164673143 19:30084543-30084565 CAGAGGGAGCCCAGGGAATGTGG - Intergenic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1167080767 19:47274903-47274925 CCGAGTGGGCTGCGGGGATGCGG + Exonic
925597581 2:5571151-5571173 CTGAGTGAACGGAGGGAAAGAGG - Intergenic
926696020 2:15770662-15770684 CTGGGTGAGGCGAGGGGATGTGG + Intergenic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
932484545 2:72075705-72075727 CTCAGTCAGCTGAGGGAATGCGG - Intergenic
936935826 2:117837157-117837179 CCGCATGAGCCGAGGCAAAGGGG + Intergenic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
945318173 2:208392829-208392851 CAGACTGAGCCGCTGGAATGGGG + Intronic
946175326 2:217918949-217918971 CCTAGTGAGACCAGGGAAGGAGG + Intronic
1170935386 20:20805115-20805137 CCGGGTGGGCCAAGAGAATGTGG + Intergenic
1174354250 20:49987826-49987848 CCGAGTGAGCCGTGGGACAACGG - Intronic
1178494451 21:33075278-33075300 CCGTGTGAGCAGAAAGAATGTGG - Intergenic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1180960081 22:19758630-19758652 CCGAGGGAGCCGAGGACACGAGG - Intronic
1181031599 22:20150833-20150855 CTGAGTGAGCAGAGGAGATGGGG + Exonic
1181511793 22:23392684-23392706 CTGAGTGAGCAGAGGAGATGGGG - Intergenic
1181911680 22:26243401-26243423 CAGAGAGAGCTGAGTGAATGAGG + Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182711622 22:32326828-32326850 CAGAGTCAGCGGAGGGGATGTGG + Intergenic
1184278988 22:43426548-43426570 CCGAGTGGTCCGAGGGACAGCGG - Intronic
1185285306 22:49997301-49997323 CTCAGTGAGCCGAGAGAGTGGGG - Exonic
954755663 3:52838191-52838213 CCCAGTGAGCAGAGGGTTTGGGG - Exonic
959262944 3:104103734-104103756 CCCAGTGAGAAGTGGGAATGAGG + Intergenic
960978692 3:123201839-123201861 CTGGGTGAGCTGAGGGAACGGGG + Intronic
961552051 3:127674999-127675021 CAGGGAGAGCCGAAGGAATGAGG - Intronic
964494918 3:157278404-157278426 CAAAGAGAGCAGAGGGAATGTGG + Intronic
966418373 3:179713574-179713596 CTGAGTGAGCCCAGCGAGTGTGG - Intronic
968592015 4:1464053-1464075 CTGGGAGACCCGAGGGAATGTGG + Intergenic
968656250 4:1779638-1779660 CCGAGTGCTCCCAGGGAATGGGG + Intergenic
970416897 4:15867007-15867029 GCAAGTGAGCCAAGTGAATGGGG + Intergenic
986237511 5:5925912-5925934 CCCAGTGAGGCTAGGGAATCTGG + Intergenic
997221507 5:132170095-132170117 CATAGTGAGCAAAGGGAATGTGG - Intergenic
997583220 5:135030187-135030209 CCGAGTGGGCAGAGGGCATGCGG - Intronic
1000304554 5:159983568-159983590 CCGTCTTAGCCGTGGGAATGTGG + Intergenic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1003325076 6:5085142-5085164 CCGAGTGCTCCGGTGGAATGCGG - Exonic
1005693910 6:28333900-28333922 GAGAATGAGCTGAGGGAATGAGG + Intronic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1019568475 7:1696747-1696769 CGGAGTTAGCCGAGGTCATGAGG - Intronic
1023381947 7:39617199-39617221 CAGAGTCAGCCAAGGAAATGGGG - Intergenic
1027660269 7:80980535-80980557 AAGAGTCAGCCAAGGGAATGAGG + Intergenic
1030814590 7:114020319-114020341 GCGACAGAGCTGAGGGAATGGGG + Intronic
1035051985 7:156004244-156004266 CCGGGTGAGGTGAGTGAATGCGG - Intergenic
1036239465 8:7069954-7069976 CCGAGAGAGGCAAGGGAAGGGGG + Intergenic
1036929599 8:12942196-12942218 CCCAGAGAGGCAAGGGAATGAGG - Intergenic
1040299564 8:46180861-46180883 CTGGGTGAGCCGAGGGACTCAGG - Intergenic
1040562192 8:48532915-48532937 CGGAGTGGGCCGATGGAGTGAGG - Intergenic
1044122650 8:88416380-88416402 CAGAGTCAGAGGAGGGAATGTGG + Intergenic
1048225792 8:132584177-132584199 CGCAGTGAGCCGGGAGAATGAGG - Intronic
1050515325 9:6437558-6437580 CCAAGTGAGTCGATAGAATGTGG + Intronic
1061445130 9:130633330-130633352 CCAAGCGAGCAGAGGGAAAGGGG - Intronic
1062452779 9:136622524-136622546 CTGAGTGAGCCGAGGGCTGGGGG + Intergenic
1200149908 X:153946335-153946357 ACAAGTGAGCTGAAGGAATGCGG + Intergenic