ID: 1150840379

View in Genome Browser
Species Human (GRCh38)
Location 17:68601010-68601032
Sequence CCCGCGGTGGCAGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 251}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150840379_1150840387 -8 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840387 17:68601025-68601047 ACCGCGGGCGGACGGGCGACGGG 0: 1
1: 0
2: 1
3: 10
4: 83
1150840379_1150840386 -9 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840386 17:68601024-68601046 CACCGCGGGCGGACGGGCGACGG 0: 1
1: 1
2: 1
3: 15
4: 81
1150840379_1150840400 23 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840400 17:68601056-68601078 CGACCGCGGAGGGCGGACGGAGG 0: 1
1: 0
2: 1
3: 18
4: 146
1150840379_1150840396 12 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840396 17:68601045-68601067 GGGGCGGGGGGCGACCGCGGAGG 0: 1
1: 0
2: 7
3: 133
4: 1011
1150840379_1150840398 16 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840398 17:68601049-68601071 CGGGGGGCGACCGCGGAGGGCGG 0: 1
1: 0
2: 6
3: 23
4: 299
1150840379_1150840390 -4 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840390 17:68601029-68601051 CGGGCGGACGGGCGACGGGGCGG 0: 1
1: 0
2: 3
3: 35
4: 349
1150840379_1150840394 0 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840394 17:68601033-68601055 CGGACGGGCGACGGGGCGGGGGG 0: 1
1: 0
2: 5
3: 42
4: 357
1150840379_1150840395 9 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840395 17:68601042-68601064 GACGGGGCGGGGGGCGACCGCGG 0: 1
1: 0
2: 4
3: 44
4: 409
1150840379_1150840397 13 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840397 17:68601046-68601068 GGGCGGGGGGCGACCGCGGAGGG 0: 1
1: 0
2: 3
3: 33
4: 352
1150840379_1150840391 -3 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840391 17:68601030-68601052 GGGCGGACGGGCGACGGGGCGGG 0: 1
1: 0
2: 5
3: 57
4: 535
1150840379_1150840402 30 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840402 17:68601063-68601085 GGAGGGCGGACGGAGGCCGCCGG 0: 1
1: 0
2: 5
3: 34
4: 394
1150840379_1150840392 -2 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840392 17:68601031-68601053 GGCGGACGGGCGACGGGGCGGGG 0: 1
1: 0
2: 1
3: 50
4: 433
1150840379_1150840389 -7 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840389 17:68601026-68601048 CCGCGGGCGGACGGGCGACGGGG 0: 1
1: 0
2: 2
3: 25
4: 170
1150840379_1150840399 20 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840399 17:68601053-68601075 GGGCGACCGCGGAGGGCGGACGG 0: 1
1: 0
2: 2
3: 26
4: 312
1150840379_1150840393 -1 Left 1150840379 17:68601010-68601032 CCGGCGCCGGCTGCCACCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 251
Right 1150840393 17:68601032-68601054 GCGGACGGGCGACGGGGCGGGGG 0: 1
1: 0
2: 0
3: 54
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150840379 Original CRISPR CCCGCGGTGGCAGCCGGCGC CGG (reversed) Exonic
900082619 1:869908-869930 CCCCTGGTGGCAGCCGGCTCCGG - Intergenic
900180216 1:1307949-1307971 CCGGCGGTGACAGGCGGGGCGGG - Exonic
900550088 1:3250261-3250283 TCCAAGGTGGCAGCCGGCCCTGG + Intronic
901489265 1:9588596-9588618 CCGGAGGTGGAAGGCGGCGCGGG - Intergenic
903034926 1:20486883-20486905 CCAGCGGAGGCAGCGGACGCCGG - Intergenic
903652366 1:24929914-24929936 CCCCCGGGGGCGGCCGGCGCGGG + Intronic
904783000 1:32964593-32964615 GCCGCAGCGGCGGCCGGCGCCGG - Exonic
905416523 1:37808125-37808147 GCCGCGGTGGCTGCCAGCGTGGG - Exonic
905546454 1:38804101-38804123 CCCGCTGTGGCCGCTGGCGCCGG + Intergenic
906525461 1:46490834-46490856 CCCGCGGCCTCAGCCGGCGTGGG + Intergenic
906614548 1:47225497-47225519 GCGGCGGGGGCAGCCAGCGCGGG + Exonic
907291129 1:53413650-53413672 CCCGGGGTGGCAGCTGGGGATGG + Intergenic
907906114 1:58784579-58784601 CGCGCGGTGGCGGCCGCCGGTGG - Intergenic
913528013 1:119712459-119712481 GCCGCGCTGGCATCCCGCGCTGG - Intronic
914001719 1:143699944-143699966 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914490911 1:148149619-148149641 CCCTGGGTGGGGGCCGGCGCGGG - Intronic
914514565 1:148362851-148362873 CCCGCTGCGGGAGCCGGCGGAGG + Intergenic
914519430 1:148402392-148402414 CCCGCTGTCGGAGCCGGCGGGGG - Intergenic
914643930 1:149636428-149636450 CCCGCTGTCGGAGCCGGCGGGGG - Intergenic
919913769 1:202127911-202127933 CCTGCTGTGGCAGCTGGCACAGG + Exonic
921039507 1:211416578-211416600 CCCGCGCGGGCCGCAGGCGCCGG + Intergenic
921472722 1:215567713-215567735 CCCGCGGCGGCGGCCGGCAGCGG + Exonic
924172419 1:241356684-241356706 GCCGCGGCGGCCGCCGGAGCCGG + Intronic
924511209 1:244730475-244730497 CGCGCGGGGGCGGCCTGCGCGGG + Intergenic
1062760085 10:11446-11468 CCCCTGGTGGCAGCCGGCTCAGG - Intergenic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1064020413 10:11804728-11804750 CCCGCCTTGGCAGCCGTGGCGGG + Intergenic
1064553048 10:16521393-16521415 CCTGTGGCTGCAGCCGGCGCCGG + Exonic
1065441468 10:25756632-25756654 CCCGCAGTGGCAACCCGCTCGGG + Intergenic
1065579348 10:27155421-27155443 CCCGCGGTGGGATCCATCGCTGG - Exonic
1066758127 10:38730544-38730566 CCGGCGGTGGGAGCCGGGCCAGG + Intergenic
1069832818 10:71291477-71291499 TCCGCGGTAGATGCCGGCGCTGG - Exonic
1072915601 10:99535750-99535772 CCCGCGGCGCCAGGCTGCGCTGG - Exonic
1074040010 10:109779205-109779227 CCCGGGGTGGCGGCGGGGGCAGG - Intergenic
1074503472 10:114045472-114045494 CCCGCCGTTGCAGCCGGCCCAGG - Exonic
1076638947 10:131901134-131901156 CCTGCCATGGCAGCCGGCGGCGG - Exonic
1076998614 11:311203-311225 CCCCTGGCGGCGGCCGGCGCAGG + Intronic
1077000129 11:318556-318578 CCCCTGGCGGCGGCCGGCGCAGG - Intergenic
1077077921 11:709546-709568 CCTGCAGTGGCAGCCTGGGCCGG + Exonic
1077815745 11:5683859-5683881 CCAGCAGTGGCAACCTGCGCTGG + Intronic
1078474911 11:11621953-11621975 ACCGCCAAGGCAGCCGGCGCTGG - Exonic
1081636836 11:44727175-44727197 GCCGGGAAGGCAGCCGGCGCCGG + Intronic
1081672815 11:44950968-44950990 CCCAGGGTGGCCGCCGGGGCGGG + Intronic
1081773904 11:45665212-45665234 CCCGAGGATGGAGCCGGCGCTGG - Exonic
1082283655 11:50298206-50298228 GCCGCGGCTGCAGCTGGCGCTGG + Intergenic
1083595539 11:63916942-63916964 CCCGCGACGGCAGCCGGCCGGGG + Intergenic
1083747132 11:64742859-64742881 CCTGCCATGGCCGCCGGCGCGGG + Exonic
1083970127 11:66069823-66069845 CCCGCGGTGGCAGCGGGCCCCGG + Intergenic
1084000146 11:66291762-66291784 CCCGCGGTGCCAGGCGCTGCCGG + Intergenic
1085266795 11:75242142-75242164 CCCGCGGGCGCGGCGGGCGCGGG - Exonic
1090782850 11:130022428-130022450 CCAGCGGTGGCAACCCGCTCGGG + Intergenic
1091201352 11:133783226-133783248 CCAGCGGTGGCAACCCGCTCGGG + Intergenic
1092834095 12:12472021-12472043 CCAGCGGTGGCAACCCGCTCGGG - Intergenic
1096241398 12:49961980-49962002 CCCGCCGCGGCAGCTGCCGCCGG + Exonic
1097925312 12:65121116-65121138 CCCGCAGTGCCAGCAGGCACAGG + Exonic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1098029055 12:66235420-66235442 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
1100166481 12:91923438-91923460 CCCGCAGTGGCAACCTGCTCGGG - Intergenic
1103439081 12:120949852-120949874 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
1104568423 12:129904368-129904390 CGCGCGGTGGCGGCGGGCGAGGG + Intergenic
1104674783 12:130705087-130705109 CCCCCAGAGGCAGCCGGTGCTGG - Intronic
1111602867 13:90495714-90495736 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
1111841224 13:93453886-93453908 CCAGCAGTGGCAGCCCGCTCAGG - Intronic
1112208194 13:97346728-97346750 CCCGCGGTGGCCGGGGCCGCAGG + Intronic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1113379004 13:109786313-109786335 CCCGAGGAGGCAGCGGCCGCAGG - Exonic
1113737652 13:112689943-112689965 CCCGCGGCCGCAGCCCCCGCCGG - Intergenic
1114031420 14:18583851-18583873 CCCCTGGTGGCAGCCGGCTCCGG - Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118288997 14:64503779-64503801 CCCGCGCCGGCAGCCCGCGATGG + Exonic
1118323213 14:64765281-64765303 CCCGCTGTGGCAGGCTGCACTGG - Intronic
1119004090 14:70908215-70908237 CGGGCGGGGGCGGCCGGCGCGGG - Intronic
1120387651 14:83866278-83866300 CCAGCAGTGGCAGCCTGCTCGGG + Intergenic
1121252940 14:92513430-92513452 CCCGCGGTCGGCGCCGGCACAGG + Intergenic
1122152641 14:99733072-99733094 CAGGCGGTGGCAGCCGGGGAGGG + Intergenic
1122722158 14:103728193-103728215 CCCCGGGTGGAACCCGGCGCCGG + Intronic
1123023041 14:105411210-105411232 CCCGCGCCGGGAGCTGGCGCTGG + Intronic
1123441529 15:20295265-20295287 CCGGCGGTGGGAGCCGGGCCGGG + Intergenic
1123699620 15:22904409-22904431 TCCGATGTGGCAGCCGGGGCCGG + Intronic
1124497705 15:30196360-30196382 CCCGAGGTGGGAGCCCGCGGTGG + Intergenic
1124575501 15:30904090-30904112 GCGGTGGTGGCAGCCGGCGCGGG + Intronic
1125796765 15:42409181-42409203 CCGGAGGTGGCAGCAGGAGCTGG - Intronic
1126725020 15:51622894-51622916 CCCGCGGTGGGCGCGCGCGCTGG - Intergenic
1130115483 15:81001651-81001673 CCCGCGACGGCGGCCGGGGCTGG - Exonic
1130162322 15:81414003-81414025 CCAGCAGAGGCAGCCGGCTCCGG - Intergenic
1130317651 15:82810041-82810063 CCCGCGGCTGCCGCCGGAGCTGG + Exonic
1131144336 15:90001666-90001688 CCCGCGCTGCCGGCCGGCGGGGG + Intronic
1132055837 15:98649688-98649710 CCCGCAGTGGCCGCGGGCGGCGG - Intronic
1132563662 16:610660-610682 CCCGCGCTGGGGGACGGCGCAGG - Intronic
1132584628 16:700832-700854 TCCGCGGTGGAAGCCAGCCCGGG - Intronic
1132604546 16:788296-788318 CGCGCGGCTGGAGCCGGCGCCGG - Intronic
1133201737 16:4207897-4207919 CCCGCGCTGGCGGCAGACGCGGG + Intronic
1133207494 16:4242115-4242137 CCGGCCGTGGCAGCAGGCGGTGG + Intergenic
1133223033 16:4327507-4327529 CCCGCCCTGGCAGGCGGGGCCGG - Intronic
1133933719 16:10252385-10252407 GCCGCGGCGGCAGCCCGGGCTGG - Intergenic
1135158284 16:20072824-20072846 CCTGAGGTGGCAGCCACCGCAGG + Intronic
1136276104 16:29180343-29180365 CCTGCAGTGGCAGCCGTGGCTGG + Intergenic
1136724711 16:32348642-32348664 CCGGCGGTGGGAGCCGGGCCGGG - Intergenic
1139511654 16:67431392-67431414 CCGGCGGGGGCAGCAGGCGCTGG - Exonic
1139546892 16:67653668-67653690 CCCGCGGGGGCAGCGGGCACTGG + Intronic
1141430528 16:83968509-83968531 CCCGCGGTGTCCGCGGCCGCGGG + Intergenic
1142080483 16:88146405-88146427 CCTGCAGTGGCAGCCGTGGCTGG + Intergenic
1203001719 16_KI270728v1_random:169113-169135 CCGGCGGTGGGAGCCGGGCCGGG + Intergenic
1142594338 17:1022302-1022324 GCCACGGTGGCAGCCCGGGCTGG + Intronic
1142849607 17:2697955-2697977 GGCGCGGGGGAAGCCGGCGCGGG + Exonic
1143172860 17:4940032-4940054 CACCCGCTGGAAGCCGGCGCGGG + Exonic
1144021345 17:11241638-11241660 CCGGCGGGGGCAGCCCGCGGCGG + Exonic
1145912886 17:28552599-28552621 CCCCCGGCTCCAGCCGGCGCAGG - Exonic
1146581155 17:34040010-34040032 CCGGCGGTGGCTGCCCGGGCGGG - Intronic
1146747592 17:35345968-35345990 CCCGCGGTGACAGCCGTTCCCGG - Intergenic
1147743072 17:42679613-42679635 CCGGCGGGGGCAGCCGCGGCGGG + Exonic
1150108609 17:62479136-62479158 CCCGCCCGGGCAGCCGCCGCCGG - Exonic
1150407952 17:64919113-64919135 ACCGCGGCAGCAGCCGGGGCAGG - Intronic
1150747270 17:67825852-67825874 ACCGCGGCAGCAGCCGGGGCAGG + Exonic
1150840379 17:68601010-68601032 CCCGCGGTGGCAGCCGGCGCCGG - Exonic
1151801955 17:76384159-76384181 CCCGCGGGTGCTGTCGGCGCCGG - Intronic
1152279586 17:79377599-79377621 TCCACGGTGACAGCCGGAGCAGG + Intronic
1152392936 17:80013464-80013486 CCCCCGGTGGCAGCGGCAGCGGG - Exonic
1152781621 17:82229454-82229476 TCCGCGGTGGCGGGGGGCGCGGG + Intronic
1152868005 17:82735695-82735717 CTCGCTGATGCAGCCGGCGCCGG - Exonic
1152952993 18:11799-11821 CCCCTGGTGGCAGCCGGCTCAGG - Intergenic
1153515265 18:5895709-5895731 GCGGCGGAGGCAGCCGGCACGGG + Intronic
1154125697 18:11689990-11690012 CCCGCGGGGGCGGCGGGCACCGG + Intronic
1155053257 18:22165797-22165819 CCGCCGGCGGGAGCCGGCGCTGG + Intergenic
1157384089 18:47247581-47247603 CCCGCCGGGGCAGCCCCCGCAGG - Intronic
1157661971 18:49453319-49453341 CCAGCAGTGGCAACCGGCTCAGG + Intronic
1157689197 18:49667181-49667203 CCCTCGGAGGCTGCCGGTGCTGG + Intergenic
1160453398 18:78979950-78979972 CCCGCGATGTGAGGCGGCGCCGG + Intergenic
1160499100 18:79393819-79393841 CCCGCGGTGGCCGCAGAGGCCGG + Intergenic
1160893283 19:1390752-1390774 CCCGGGGCGGCAGCCGGCAGAGG - Intronic
1160909758 19:1469112-1469134 CCAGCGGTGGCGGCCCACGCCGG - Exonic
1160994674 19:1877125-1877147 CCCTGGGTGGGGGCCGGCGCGGG + Exonic
1161031387 19:2059423-2059445 CCCGCGGAGGCAGGCGTCCCTGG + Intergenic
1162805456 19:13135904-13135926 CCCGCCGTGGCTGCGGGAGCAGG + Exonic
1163631439 19:18419759-18419781 CGCGCGGTGCCCGCCCGCGCCGG - Intronic
1164914611 19:32041782-32041804 TGCGCGGTGGGACCCGGCGCTGG - Intergenic
1166087652 19:40487754-40487776 CCCGATGTGGCAGCCCACGCGGG - Exonic
1166305162 19:41933119-41933141 CGCGAGGTGGCAGCCGGCCCGGG + Intergenic
1167293262 19:48635850-48635872 CCCGCGGGGGCGCCCGGGGCCGG - Exonic
1167454459 19:49591273-49591295 CCCGGGGTGGGTGCAGGCGCTGG - Intergenic
1167501561 19:49851360-49851382 CCCGAGGGGGCCCCCGGCGCCGG - Exonic
1168297322 19:55383789-55383811 CACGCGGCGGGAGCCGGCGGCGG + Exonic
925730671 2:6917761-6917783 CGCCCGGTGGCAGCGGGCGGGGG + Intronic
926153026 2:10435084-10435106 CCCGCGGTGGCAGCGCGGTCGGG - Intergenic
927990171 2:27442148-27442170 CCCGCTGGGGCGGCCGGGGCGGG + Exonic
929966732 2:46542554-46542576 CGCGCGGCGGCAGCAGGCGGGGG + Intronic
932440371 2:71731085-71731107 CCCGCAGGGGCGCCCGGCGCCGG - Intergenic
933537847 2:83599619-83599641 CCAGCAGTGGCAACCGGCTCGGG - Intergenic
933778317 2:85785212-85785234 CCCGCCCAGGCAGCCAGCGCCGG + Intronic
933847423 2:86337268-86337290 GCCCAGGAGGCAGCCGGCGCCGG - Intronic
933885894 2:86719529-86719551 GCAGCGCTGACAGCCGGCGCGGG + Intronic
933924286 2:87077176-87077198 GCAGCGCTGACAGCCGGCGCGGG - Intergenic
934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG + Intergenic
935820161 2:106886452-106886474 CCCGCGCTTGCAGCTGCCGCCGG - Exonic
936347043 2:111682834-111682856 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
937289440 2:120773407-120773429 CCCGCGGTGACAGCCCAGGCAGG + Intronic
937950886 2:127387525-127387547 GCCGCGGTGACAGGCCGCGCTGG - Intronic
938496780 2:131801945-131801967 CCCCTGGTGGCAGCCGGCTCCGG + Intergenic
940009443 2:149038701-149038723 CGCGCGGTAGCAGCCAACGCCGG + Exonic
941020971 2:160407661-160407683 CGCGCGGCGGCGGCCGGCGGGGG + Intronic
945033068 2:205682798-205682820 CGGGCGGAGGCAGCCGCCGCCGG - Exonic
946026018 2:216672081-216672103 CCCTCGGAGGAAGCCGACGCAGG + Intergenic
948421064 2:237860097-237860119 GCCGCGGTGACTGCCAGCGCAGG + Intronic
1169358224 20:4925622-4925644 CCTGCGGTGGGTGCCGGGGCAGG - Intronic
1171570837 20:26250525-26250547 CCCTCGGTGGAAGTCGGCTCAGG - Intergenic
1172855681 20:38000472-38000494 CCCGCGTGGGCGGCCAGCGCAGG + Intronic
1173586536 20:44187105-44187127 CCCTCGGTGGCAGCCCCCGCCGG + Exonic
1173741638 20:45406319-45406341 CCCGCGGCGGGCGCCCGCGCCGG - Intronic
1173778906 20:45736819-45736841 CCAGCAGTGGCAACCGGCTCAGG + Intergenic
1175847206 20:62065299-62065321 GCCGCGCTGGCCGCCCGCGCCGG - Exonic
1175993043 20:62798920-62798942 CCCACGGTGGTGGCCGACGCTGG - Intronic
1176131603 20:63498875-63498897 CCCGGGGTGGGGGGCGGCGCGGG - Intronic
1176219782 20:63964453-63964475 CCAGGGGTGGCGGCCGGGGCAGG - Intronic
1177775524 21:25562158-25562180 CCCGAGGCTGCAGGCGGCGCTGG - Intergenic
1179999695 21:44989799-44989821 GCCGCCGTGGCAGACAGCGCGGG + Intergenic
1180077773 21:45471942-45471964 CCCGTGGTGGCCGCTGGCTCCGG - Intronic
1180309694 22:11158953-11158975 CCGGCGGTGGGAGCCGGGCCAGG + Intergenic
1180455533 22:15510908-15510930 CCCCTGGTGGCAGCCGGCTCCGG - Intergenic
1180548171 22:16520763-16520785 CCGGCGGTGGGAGCCGGGCCAGG + Intergenic
1180572998 22:16747544-16747566 CCCTCGGTGGAAGTCGGCTCAGG - Intergenic
1181586816 22:23857175-23857197 CCGGCAGTGGCGACCGGCGCAGG + Intronic
1181632029 22:24156394-24156416 CGCGCGGGGGCGGCAGGCGCTGG + Intronic
1182211271 22:28679553-28679575 CCGGCGGTGGGAGCCGGGCCGGG - Intronic
1182442109 22:30370701-30370723 CCCACGGTGGCAGCCGGCAGTGG - Exonic
1184472189 22:44702279-44702301 CCCGGCGGGGCGGCCGGCGCGGG + Intronic
1184784370 22:46664619-46664641 CCCGCTGGGGCAGCCGCTGCAGG - Intronic
1185248677 22:49787638-49787660 ACCGCGGAGGCCGCCGCCGCCGG + Intronic
949292902 3:2485933-2485955 CCAGCAGTGGCAACCCGCGCAGG + Intronic
950703551 3:14766552-14766574 CCCTCAGGGGCAGCCGGCGAGGG + Intronic
952302409 3:32115049-32115071 CCAGTGGTGGCAACCGGCTCAGG - Intronic
952924966 3:38314002-38314024 CCGGCCGTGGCAGGCGGCACTGG - Intronic
953912185 3:46898825-46898847 GCGGCGGTGGCAGGCGGCGGGGG - Exonic
954367517 3:50154550-50154572 CCGGCGGTGCCAGCCGTCCCAGG + Intergenic
955186553 3:56719796-56719818 CCAGCGGTGGCAACCCGCTCGGG + Intergenic
955916358 3:63912220-63912242 CCCACCATGGCAGCCCGCGCGGG - Intronic
958503780 3:94946855-94946877 CAGGCAGTGGCAGCCGGTGCTGG + Intergenic
958949423 3:100400820-100400842 GCCGCGATGGCAGCTGGCTCTGG - Exonic
962758400 3:138485671-138485693 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
963020916 3:140872451-140872473 CCAGCTGTGGCAGCCTGCTCAGG + Intergenic
964569204 3:158094469-158094491 CCCGCGGAGGCAGCCAGGTCCGG - Intergenic
965256896 3:166424594-166424616 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
968084376 3:195867909-195867931 CCCGCGGAGGCACCCGGGGAGGG + Exonic
969362478 4:6673439-6673461 CCAGCAGTGGCAACCGGCTCAGG + Intergenic
969605271 4:8199307-8199329 CCCGTGGGGCCAGCCAGCGCTGG + Intronic
969619086 4:8269936-8269958 CCCGCGCTGCCACCCGCCGCCGG + Exonic
969715876 4:8867850-8867872 CCCCCGGCCGCAGCCGCCGCTGG - Exonic
972960614 4:44448266-44448288 CCCGTGGCGGCGCCCGGCGCCGG - Exonic
975439821 4:74398642-74398664 CCCGCAGTGGCAACCCGCTCAGG - Intergenic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
984973405 4:185209869-185209891 CCCGCGCGGGCCGCAGGCGCCGG + Intronic
986152134 5:5138571-5138593 CCAGCCGTGGCAACCGGCTCAGG + Intergenic
987146118 5:14993381-14993403 CCAGCAGTGGCAGCCCGCTCGGG - Intergenic
993041803 5:82823186-82823208 CCAGCAGTGGCAACCGGCTCGGG - Intergenic
997304114 5:132825860-132825882 CCCGCGGTTGCAGCCCGCAGTGG - Exonic
999696219 5:154190599-154190621 GACGCGGGGGCAGGCGGCGCGGG + Intronic
1002168389 5:177361954-177361976 CCTGCAGTGGCAGCCAGGGCAGG + Intronic
1002487729 5:179550920-179550942 TCCCCGCTGGCCGCCGGCGCGGG + Intronic
1002991859 6:2245721-2245743 CGCGCGGTGGCCGTCGGCGGAGG - Intergenic
1003567158 6:7231082-7231104 TCCGGGGTGGCCGCCGGAGCAGG - Exonic
1007415929 6:41691209-41691231 GCCATGGTGGCTGCCGGCGCTGG + Exonic
1007769253 6:44180053-44180075 CCCCCGGAGGCAGCCGGAGTTGG - Exonic
1007902027 6:45421969-45421991 GCCGGGCTGGCAGCCGCCGCGGG + Intronic
1011693056 6:89887566-89887588 CCCGCTGTGGCAGCCCGGGAGGG + Intergenic
1013694672 6:112688911-112688933 CCAGCAGTGGCAGCCGGCTCGGG - Intergenic
1014230101 6:118893978-118894000 CGCGCGGAGGCCGCCGGCGGCGG - Intronic
1015149219 6:130019840-130019862 CCCGCGGCGGCCGTCCGCGCGGG + Intronic
1015994940 6:138987944-138987966 CCCGCGGCCGGAGCCGGAGCCGG - Exonic
1016923181 6:149316981-149317003 CCCGCGGCGGAGGCTGGCGCCGG - Intronic
1018807228 6:167270844-167270866 CCCACGGTGTCAGCCGGGCCAGG - Intergenic
1020178092 7:5898777-5898799 CCCGAGGTGGGGGCCGGGGCGGG + Exonic
1020180683 7:5920153-5920175 CCCACGCTGGCAGCTGGGGCTGG + Intronic
1020302247 7:6804729-6804751 CCCACGCTGGCAGCTGGGGCTGG - Intronic
1020304835 7:6826198-6826220 CCCGAGGTGGGGGCCGGGGCGGG - Exonic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1026516586 7:71078206-71078228 CCCGCGGAGGCAGCTGAGGCCGG - Intergenic
1027228584 7:76260007-76260029 CCCGCGGTGGCCGCGGTAGCAGG - Exonic
1028585511 7:92447702-92447724 CCCGCGGGGGCCGCCCGAGCCGG + Exonic
1029363222 7:100101580-100101602 CCCGCGGTCCGAGCTGGCGCGGG + Exonic
1031406920 7:121396551-121396573 CCCGTAGTGCCACCCGGCGCAGG - Intergenic
1031531922 7:122886386-122886408 CCCGCGGGCGCAGCCGCCGGGGG - Intronic
1032460138 7:132104174-132104196 CCCGAGCTGGCAGCAGGGGCAGG + Intergenic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1039843445 8:41309334-41309356 CCTGCGGTCGGAGGCGGCGCGGG + Exonic
1041135239 8:54750948-54750970 CCAGCGGTGGCAACCTGCTCGGG + Intergenic
1042916188 8:73878395-73878417 CCCGCGGTTGTTGCCGGGGCAGG - Intronic
1048553984 8:135457632-135457654 AGCGCGGGGGCCGCCGGCGCTGG + Exonic
1049602477 8:143514308-143514330 CCTGCGGTGGCAGCCCGGGTGGG - Intronic
1049621056 8:143598522-143598544 CCCGCGCTGCCCTCCGGCGCCGG + Exonic
1049680609 8:143916309-143916331 GCCGCGGCGGGAGCCGGCCCGGG + Exonic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1049711151 8:144063944-144063966 CCAGCGGCGGCAGCTGGCGGGGG + Intergenic
1049721181 8:144116206-144116228 GCCGCGGGGGCAGCGGGCGCGGG - Exonic
1050295061 9:4196376-4196398 CCAGCAGTGGCAACCGGCTCAGG + Intronic
1054870551 9:70044281-70044303 CCCCCGGGGGCAGCAGGAGCGGG - Intronic
1056143544 9:83707582-83707604 TCCGCGGAGGCAGCGGCCGCGGG + Exonic
1058023688 9:100117526-100117548 TCCGCAGTGGCATCCGGGGCCGG - Intronic
1058885849 9:109320725-109320747 CCCGCGCAGGCCGCCGGCCCGGG - Exonic
1059061367 9:111038166-111038188 CGCGCGGCGGCAGCGAGCGCAGG - Intronic
1060796982 9:126519196-126519218 TCCGCGGTGGCTGCCGGGGGAGG - Intergenic
1061522192 9:131125396-131125418 CCCGCCTTCGCAGCCAGCGCGGG - Intergenic
1061962106 9:133993457-133993479 CCCAGGGTCGCAGCCGGCCCCGG + Intergenic
1061970420 9:134041878-134041900 GCCGCGGGGGCAGGCAGCGCCGG + Exonic
1062367246 9:136216763-136216785 CCCGCGGTGGGGGCGGGCCCGGG - Intronic
1062629968 9:137459143-137459165 CCGGCGGAGGCGGCGGGCGCGGG - Exonic
1185482968 X:461210-461232 CACGGGGCGGCAGCCGGGGCCGG - Intergenic
1187648294 X:21374030-21374052 CCCGCCGTGGCCGCCACCGCCGG + Intergenic
1189398942 X:40647332-40647354 GCCGCCGCGGCAGACGGCGCGGG + Exonic
1189915416 X:45851304-45851326 CCCGCGGTGGCCGGGGGAGCGGG + Intergenic
1190108602 X:47575160-47575182 CCCGCTGTCGCTGCCGGGGCAGG + Exonic
1200439058 Y:3189183-3189205 CCAGCAGTGGCAACCGGCTCGGG + Intergenic
1202136960 Y:21676241-21676263 CCAGCAGTGGCAACCGGCTCGGG - Intergenic