ID: 1150850728

View in Genome Browser
Species Human (GRCh38)
Location 17:68701467-68701489
Sequence CATTATGAGCTGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150850718_1150850728 29 Left 1150850718 17:68701415-68701437 CCAGTGGAAAAGTCATGATACAG No data
Right 1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150850728 Original CRISPR CATTATGAGCTGGTGGAGCT GGG Intergenic
No off target data available for this crispr