ID: 1150851065

View in Genome Browser
Species Human (GRCh38)
Location 17:68704121-68704143
Sequence CTCAAGGGCTTGACTCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150851057_1150851065 12 Left 1150851057 17:68704086-68704108 CCTCAGTCCAGTCACAGCCAAAC No data
Right 1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG No data
1150851059_1150851065 -5 Left 1150851059 17:68704103-68704125 CCAAACCCCTGAATTTAGCTCAA No data
Right 1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG No data
1150851058_1150851065 5 Left 1150851058 17:68704093-68704115 CCAGTCACAGCCAAACCCCTGAA No data
Right 1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG No data
1150851062_1150851065 -10 Left 1150851062 17:68704108-68704130 CCCCTGAATTTAGCTCAAGGGCT No data
Right 1150851065 17:68704121-68704143 CTCAAGGGCTTGACTCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150851065 Original CRISPR CTCAAGGGCTTGACTCCAGT AGG Intergenic
No off target data available for this crispr