ID: 1150852252

View in Genome Browser
Species Human (GRCh38)
Location 17:68714866-68714888
Sequence CCACCTTACTTAAGCAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150852244_1150852252 19 Left 1150852244 17:68714824-68714846 CCGCAGCTTGGTCACTGAGAAAT No data
Right 1150852252 17:68714866-68714888 CCACCTTACTTAAGCAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150852252 Original CRISPR CCACCTTACTTAAGCAAAAT TGG Intergenic
No off target data available for this crispr